0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism" potx

báo cáo khoa học:

báo cáo khoa học: " Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism" potx

... Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism BMC Plant Biology 2010, 10:67Miao ... (AJ223969) forward:5'-AGACCACCAAGTACTACTGCAC-3'reverse:5'-CCACCAATCTTGTACACATCC-3'58 495Ghdhg-OMT(GQ303569)forward:5'-ATGAATATGGGCAATGCTAAT-3'reverse:5'-TCAGGGGTAAACCTCAATGAGA-3'53 ... forward:5'-AGAGGCTTACGCAGCAGGTC-3'reverse:5'-GCCAGTCTTTACGGCGAGTT-3'52 310NOS forward:5'-GAACTGACAGAACCGCAACG-3'reverse:5'-ACCGAGGGGAATTTATGGAA-3'50 180GhAOX 1(DQ250028) forward:5'-GCGCCTGGGGATGATGATGAGTCGTG-3'reverse:5'-GCGCTTCAGTGATAACCGAGCGGAG-3'57...
  • 14
  • 306
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Experimental infection of dogs with a feline endogenous retrovirus RD-114." pps

... (distilled water). No PCR positives were obtainedfrom any of the experimental groups A- C.Narushima et al. Acta Veterinaria Scandinavica 2011, 53:3http://www.actavetscand.com/content/53/1/3Page 3 of ... the articleNarushima et al. Acta Veterinaria Scandinavica 2011, 53:3http://www.actavetscand.com/content/53/1/3© 2011 Narushim a et al; lice nsee B ioMed Central Ltd. This is an Open Access article ... narusima@nval.maff.go.jp1National Veterinary Assay Laboratory, Ministry of Agriculture, Forestry andFisheries, 1-15-1 Tokura, Kokubunji, Tokyo 185-8511, JapanFull list of author information is available at the end of...
  • 4
  • 276
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic transformation: short review of methods and their applications, results and perspectives for forest trees" ppt

... MartinLA, Dandekar AM (1988) Agrobacterium-mediated transformation of walnut somaticembryos and regeneration of transgenicplants. Bio/Technology 6, 800-804McGranahan GH, ... 133-141Naina NS, Gupta PK, Mascarenhas AF (1989) Genetic transformation and regeneration of transgenic neem (Azadirachta indica) plantsusing Agrobacterium tumefaciens. Curr Sci58, 184-187Nilsson ... Potrykus(1991 ).Agrobacterium-mediated transformation A tumefaciens and A rhizogenes are con-sidered as natural genetic engineers dueto their ability to transfer and integrateDNA into...
  • 12
  • 417
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic characterization of porcine circovirus - 2 field isolates from PMWS pigs" potx

... homology with PCV-2 isolates from USA, Canada and France. ButCanadian isolates such as AF085695, AF086834, AF086835and AF086836 showed slightly lower homology of 96 % with two Korean isolates. Mache ... strandF1F2R11768R1696F433RACCAGCGCACTTCGGCAGTGAGTACCTTGTTGGAGAGCGTAATCCTCCGATAGAGAGCAATACTTACAGCGCACTTCTTTCGGGTGTCTTCTTCTGCGGTAACGTCCAACAAGGTACTCACAGCAG18nt20nt20nt24nt22nt22nt1∼18418∼4371696∼1717867∼8861745∼1768412∼433Table ... LeCann P.,Jestin A. , Segales J., Chmielewicz B., Plana-DuranJ., and Soike D. Characterisation of PCV-2 isolatesfrom Spain, Germany and France. Virus Res. 2000, 66,65-77.30. Mankertz A. , Mankertz...
  • 9
  • 334
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic Polymorphism of the Serum Proteins of Horses in Jeju" pps

... distribution and characteristics of serum proteins of CNH and to get a basic data for pedigree establishment andmaintenance of purity of the CNH.Materials and Methods1) Experim ental animalsThree different ... between Asia and European’s horses[15]. It was reported that GC locus is comprised of F andS alleles[3, 5] and ES locus is comprised of F, G, H, I, S,O and R alleles[5]. Andersson and Cho et al ... frequency of AlbB was higherthan that of AlbA. The frequencies of AlbA and AlbB were0.433 and 0.567 in CNH, 0.450 and 0.550 in CRH, 0.108 and0.892 in TB, respectively.χ2 values from Hardy-Weinberggenetic...
  • 9
  • 274
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic characterization of Barbari goats using microsatellite markers" docx

... snsivaselvam@hotmail.com Genetic characterization of Barbari goats using microsatellite markersJ. Ramamoorthi, K. Thilagam, S. N. Sivaselvam*, S. M. K. KarthickeyanDepartment of Animal Genetics and Breeding, Madras Veterinary ... part of India, known for better milk and meat quality, was studied as a part of genetic characterization and conservation. The genomic DNA from 50 unrelated Barbari goats were amplified via PCR ... conservation measures [1]. Materials and MethodsThe investigation was carried out on 50 unrelated animals of Barbari goats using 21 microsatellite markers. Detailed Genetic characterization of...
  • 4
  • 248
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic variability of the prion protein gene (PRNP) in wild ruminants from Italy and Scotland" ppsx

... deer samples from Scotland were 19fwd (5’ ATT TTG CAG ATA AGT CAT C 3’), 778rev (5’ AGA AGA TAA TGA AAA CAG GAA G 3’) and 315fwd (5’ CAG TAA ACC AAA AAC CAA C 3’). A detailed description of ... highest genetic distance value was between the red deer from Italy and mainland Scotland (0.089). The distance value between the Italian and Isle of Rhum deer was 0.078 and that between Mainland ... octapeptide repeats. The The PRNP gene in wild ruminants from Italy and Scotland 119Fig. 2. The phylogenetic tree of similarity among the PRNP gene sequences of the analysed wild ruminants and...
  • 6
  • 444
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Genetic analysis of ORF5 of recent Korean porcine reproductive and respiratory syndrome viruses (PRRSVs) in viremic sera collected from MLV-vaccinating or non-vaccinating farms" ppsx

... ORF 1a and 1b are located immediately downstream of the 5’ untranslated region (UTR) and involved in virus transcription and replication. ORFs 2 to 7 are located at the 3’ end of the genome and ... 329-339.11. de Lima M, Pattnaik AK, Flores EF, Osorio FA. Serologic marker candidates identified among B-cell linear epitopes of Nsp2 and structural proteins of a North American strain of porcine ... viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of 130 Hye Kwon Kim et al.the virus. Vet Rec 1998, 142, 510-512.37. van Woensel PA, Liefkens...
  • 10
  • 517
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic control of pulp and timber properties in maritime pine (Pinus pinaster Ait.)" docx

... discussed.2. MATERIALS AND METHODS2.1. Experimental trial A1 2× 12 half-diallel was used to estimate the phenotypic vari-ability and the genetic parameters (variance components,heritabilities and genetic ... single-trait genetic gains are expectedThe main requirements of forest managers and pulp manu-facturers can be roughly summarized as an increase in yieldand an improvement in wood homogeneity. ... composite traits (total height, mean density,etc.), at a unique maturation stage.No information about mat-uration effects are available and time trend analysis of height,diameter growth and density...
  • 14
  • 398
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic variability of a scattered temperate forest tree: Sorbus torminalis L. (Crantz)" ppsx

... torminalis(L.) Crantz, Revue Forestière Française 3 (1993) 229-243.[6] Frascaria N., Santi F., Gouyon P.H., Genetic differentia-tion within and among populations of chestnut (Castanea sati-vaMill.) ... among groups. For thecomparison between France and Central Europe, stan-dard errors of diversity parameters were based on thesampling of loci.Multivariate analyses (factorial analysis) based ... colonisa-tion events on the maintenance of genetic variation andon the partitioning of this variation within and amonglocal populations [8, 25, 36]. Extinction and recolonisa-tion may produce a...
  • 9
  • 252
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015