báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot

... citation purposes)Head & Face MedicineOpen AccessResearch Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, ... was 34.10 in the precancer group as compared to 53.97 in cancer group and 33.65 in the nor-mal group. The mean age in precancer and cancer groupwas higher than normal and the difference was ... antioxidantrole in cancer. No similar study has been done on serumlevels of circulating immune complexes, trace elements, (copper, iron and selenium) as a combination in oral pre- cancer and cancer. An...

Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot

... human basophil activation and histamine release and Iikura et al. [18] reported thatimmobilized secretory IgA on Sepharose beads was capa-ble of inducing basophil degranulation and histaminerelease. ... (65.5%).Dermatophagoides pteronyssinus (Dpt) was the causativeallergen in 62, Dermatophagoides farinae (Df) in 58, cathair dander in 23 and dog hair dander in 9 patients (somepatients were allergic ... infants at high risk of asthma. Lancet 2000, 13(355(9216) ):1 680-1683.21. Andersson M, Laukkanen M, Salkinojasalonen M: 3-Hydroxy fattyacids: Stable indicators of endotoxin in hay and straw dust.Journ...

Báo cáo y học: "Circulating immune complexes contain citrullinated fibrinogen in rheumatoid arthritis" ppt

... fibrinogen-containing ICs that characterise a subset of anti-CCP+ RApatients and may contribute to synovitis in RA.Materials and methodsHuman samplesAll RA and control plasma and joint samples ... chromatography wasapplied to fractionate plasma derived from an RA patient withfibrinogen-containing circulating ICs, an RA patient with circu-lating ICs but not fibrinogen-containing circulating ... USA). Staining was developedwith Liquid DAB+ (Dako, Carpinteria, CA, USA) and counter-stained with haematoxylin and eosin.StatisticsAll statistics were run using InStat™ software (GraphPad...

Báo cáo khoa học: "Circulating immune parameters predicting the progression from hospital-acquired pneumonia to septic shock in surgical patients" doc

... IL-8 and IL-6, might be explained as anexaggerated and imbalanced pro- and anti-inflammatory immune response after surgery. In general, a clinical complication of HAP is the disseminationof bacteria ... there was no significant increase in the levels of C-reactive protein, lactate and platelets (Table 3). Immune modulating mediators and clinical parameters at the onset of pneumonia and during ... seen and confirmed by two blindedresearchers. A radial artery catheter and a central-venous catheter wereinserted as routine monitoring in all patients. A pulmonaryartery catheter was inserted...

Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebraﬁsh (Danio rerio) pptx

... generallyfound in the ovary and adrenal gland. In fishes, theadrenal homolog is not as compact as the adrenal glandfound in mammals. In fishes, adrenal tissue exists as aminergic chromaffin and inter-regnal ... intracellular function(s). In vitro binding assaysrevealed a surprisingly low affinity of recombinant-derived human FABP6 and rat Fabp6 for long-chainfatty acids, such as palmitate and oleate, ... FABP6 has been given a vari-ety of names, such as ileal lipid-binding protein, intesti-nal 15 kDa protein, ileal bile acid-binding protein and gastrotropin, reflecting the speculations of authors...

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... 5¢-AAAGAATTCCTGTGGCAGGGGACCAGTGG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGGCGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAGGTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGCTGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGGTAGTAAAT; the ... 5¢-GATACGTCTCTC ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- ... and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG.The mammalian expression...

Báo cáo khoa học: "Rib fracture after stereotactic radiotherapy on follow-up thin-section computed tomography in 177 primary lung cancer patients" potx

... S .A carried out clinical data collection, dosimetry calculation and revision of clinical data. T.K, E.S and L.T carried out collection of CT data and clinical data. K.K, T.K, K.M, M .A, R.S and ... Osteosclerosis was defined as an area of increased attenuation comparable to cortex in the medulla of rib. The time at which each finding first appeared after the completion of SRT was reviewed. Final ... interpretation of CT, clinical data collection, statistical analysis and drafting this paper. H.O carried out clinical data collection, supervision of this study, editing and approving the paper....

Báo cáo khoa học: "Enhanced immune response with foot and mouth disease virus VP1 and interleukin-1 fusion genes" potx

... ...

Báo cáo khoa học: "Circulating β-endorphin, adrenocorticotrophic hormone and cortisol levels of stallions before and after short road transport: stress effect of different distances" pps

... 5 3:1 21-129.27. Hydbring E, Nyman S, Dahlborn K: Changes in plasma cortisol,plasma β-endorphin, heart rate, haematocrit and plasmaprotein concentration in horses during restraint and use of a naso-gastric ... Edited by: Grandin T. Wallingford, Oxon,CABI; 199 3:2 33-252. 21. Oikawa M, Takagi S, Anzai R, Yoshikawa H, Yoshikawa T: Pathologyof equine respiratory disease occurring in association withtransport. ... Medicine and ScienceCórdoba, Spain; 199 8:5 3-56. 26. Hamra JG, Kamerling SG, Wolfsheimer KJ, Bagwell CA: Diurnal var-iation in plasma ir-beta-endorphin levels and experimentalpain threshold in...

Báo cáo khoa học: "Circulating inflammatory mediators and organ dysfunction after cardiovascular surgery with cardiopulmonary bypass: a prospective observational study" pot

... 1Kinetics of inflammatory mediators at anesthesia induction and after cardiopulmonary bypassKinetics of inflammatory mediators at anesthesia induction and after cardiopulmonary bypass. (a) Macrophage ... MF and DASAV conducted immunoassays and data acquisition and drafted the manuscript. MLFM was involved in patientrecruitment and the acquisition of data. LAAC and HCCFNundertook a critical revision ... Souza Aranha Vieira1, Maria Lucia A Furtado de Mendon a 1, Luiz Antonio de Almeida Campos1 and Hugo Caire Castro-Faria-Neto21Núcleo de Pesquisa Translacional, Hospital Pró Cardíaco, Rua...

Xem thêm