0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Occlusal adjustment using the bite plate-induced occlusal position as a reference position for temporomandibular disorders: a pilot study" ppsx

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf

... re-trieval using dependency relations. In SIGIR 2005,Salvador, Brazil, August.Radu Florian, Hani Hassan, Abraham Ittycheriah,Hongyan Jing, Nanda Kambhatla, Xiaoqiang Luo,Nicholas Nicolov, and Salim ... resignation of Khaddam was abrupt” as an example. In particular, the “depth” features at-tempt to capture the “importance” the dependencymatch, as measured by the depth of the ancestor in the ... 1. As a baseline, we trained and tested a model using only the lexical-matching features. We then trainedand tested models using only the low-level featuresand all features. Figure 3 shows the...
  • 4
  • 392
  • 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

... TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeIfl-SpsB3 TAGAATTCTTAATTTTTAGTATTTTCAGG EcoRItr-SpsB5 TACATATGCACCATCACCATCACCATATTGTTACACCATATA NdeIpIsaA5 TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC ... TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoIIsaA3Myc TAGAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRIRao C. V. S. et al. S. aureus type I signal peptidase SpsBFEBS Journal 276 ... truncatedSpsB contrasts with that of sc-SpsB, the fragmentobtained after self-cleavage, which was unable tocleave the substrate in the in vitro assay. The tr-SpsBhas nine additional amino acids...
  • 13
  • 464
  • 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... the Quikchange Site-Directed Mutagenesis kit (Stratagene, LaJolla, CA, USA) with forward primer 5¢-GAAACGATGCATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverseprimer 5¢-GACGCACGGTCGGCATAGGACAAATGCATCGTTTC-3¢. ... the asymmetric unit, and the glutamate-binding modes are identical to eachother (Fig. 2A) . The a- carboxyl and a- amino groupsof the bound glutamate are at the bottom of the pocket, and are held ... 5¢-CATATGGATGAGTACAAACAAGTAGATG-3¢ and reverse primer 5¢-GGATCCTCGAGCTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin-ed sequences indicate NdeI and BamHI sites, respectively). The PCR product was initially...
  • 10
  • 375
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Quantitative modeling of the neural representation of adjective-noun phrases to account for fMRI activation" doc

... assumes that the meaning of the composition is the same as the adjective: up= The noun model assumes that the meaning of the composition is the same as the noun: vp= The adjective ... exemplars the par-ticipant was viewing and thinking about. Sepa-rate classifiers were also trained for classifying the isolated nouns, the phrases, and the 4 seman-tic categories. Since fMRI acquires ... linear trend, and were temporally smoothed with a high-pass filter using a 190s cutoff. The data were normalized to the MNI template brain image using a 12-parameter affine transformation and...
  • 9
  • 270
  • 0
báo cáo khoa học:

báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf

... surrounding edema area. On the T1-weighted image after the administration of contrast material (band c), the mass has an inhomogeneous enhancement. Sagittal T1-weighted MR image without contrast (d) ... presentationof IACNS [7]. Less common complaints are aphasia,transient ischemic a ttack, ataxia, dysphasia, nausea orvomiting, loss of memory, seizure disorder, dyslalia,hypomnesia and paralysis. ... Untreated IACNSusually causes fatal outcome. Greater awareness of thesepotential manifestations of IACNS may facilitate moreaccurate diagnosis and prompt treatment.You et al. World Journal...
  • 4
  • 333
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?" pdf

... in a broad range of human tumors of glial and non-glialorigin, including gliomas, ependymomas and medullo-blastomas, as well as in several non-neural clinical speci-mens of upper and lower gastrointestinal ... geographical areas, or if there a re particularstrains more strongly associated to carcinomas.JCV DNA in normal, benign and malignantcolorectal lesionsJCV DNA sequences and proteins have been ... with age, and may be as high as 50% by the age of 10 [17]. Infection appears to occur through the gastrointestinal tract [18-20], but also it has beendetected in the respirato ry tract raising the...
  • 8
  • 400
  • 0
báo cáo khoa học:

báo cáo khoa học: "Influence of viral hepatitis status on prognosis in patients undergoing hepatic resection for hepatocellular carcinoma: a meta-analysis of observational studies" ppt

... experience and a systematicreview. World J Surg Oncol 2010, 8:55.49. Imamura H, Matsuyama Y, Tanaka E, Ohkubo T, Hasegawa K, Miyagawa S,Sugawara Y, Minagawa M, Takayama T, Kawasaki S, Makuuchi ... hepatocellularcarcinoma; NBNC-HCC = no infection of HBV or HCV related hepatocellular carcinoma; AFP = alpha fetoprotein; ALT = alanine aminotransferase; AST = aspartate aminotransferase; T-Bil = total bilirubin; ... not significantly affect the survival rate.Meta-analysis can be used to evaluate the existing lit-erature in both a qualitative and quantitative way bycompa ring and integrating the results...
  • 10
  • 359
  • 0
báo cáo khoa học:

báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx

... phosphatase 2A (PP 2A) 65 KDa regulatory subunit A TCGTGATGCTGCTGCTAACAA/TTGCCCAGTCAGGACCAAAT62/1.90SAND CF405409AT2G28390.1 SAND family protein CAACATCCTTTACCCATTGACAGA/GCATTTGATCCACTTGCAGATAAG76/1.91Sucrose ... †EC959059 AT5G60390.1 Elongation factor 1-alpha (other hits include AT1G07940.2, AT1G07940.1, AT1G07920.1, AT1G07930.1)GAACTGGGTGCTTGATAGGC/AACCAAAATATCCGGAGTAAAAGA150/1.87PP 2A CB980232AT3G25800.1 ... RNAsamples were run on an Agilent 2100 Bioanalyzer RNA6000 Nano LabChip (Agilent, Mississauga, ON, Canada), as shown in Figure 5. Total RNA was purified using anRNeasy kit (Qiagen, Valencia, CA,...
  • 11
  • 376
  • 0
báo cáo khoa học:

báo cáo khoa học: " Occlusal adjustment using the bite plate-induced occlusal position as a reference position for temporomandibular disorders: a pilot study" ppsx

... relation to this reference position. Evi-dence-based occlusal adjustment was then performedbased on the results of occlusal analysis. After the occlu-sal adjustment, the outcome was evaluated. ... performed the examination and made the diagnosis, and the treatment outcome was evaluated by the same denti st. Ano ther dentist fabricated the anterior bite plate for each patient and performed ... was to obtain occlusal stability in the BPOP. For the occlusal adjust-ment in the patient’s mouth, the anterior bite plate wasworn in the mouth; the patient was then asked to tapand slide...
  • 8
  • 208
  • 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... only data corresponding to the first 6 h are shown.Comparing the data obtained for particular temperatures(Fig. 3), it can be seen that at 37 °C, the reaction was as fastat pH 2.5 as it was at ... can be completedin as little as 3 h at 70 °C (4 h after the addition of the exopeptidase).Preparative activationActivation of (Pyr)-ONC (M23L) was performed as described in the Materials and ... transferred into the massspectrometer so that spectra could be acquired immediately. The mass spectra for the same samples were acquired again,24 h and 72 h later. Comparing the peaks of the...
  • 9
  • 704
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP