báo cáo khoa học: " Panorametry: suggestion of a method for mandibular measurements on panoramic radiographs" potx

... panorametry traced over a panoramic radiography with information for bilateral bone-dental angular measure-ments of the mandibleFigure 8Image of panorametry traced over a panoramic radi-ography ... CML and ML.BioMed CentralOpen AccessPage 1 of 9(page number not for citation purposes)Head & Face MedicineMethodology Panorametry: suggestion of a method for mandibular measurements on ... expressedin linear and angular measurements, aiming at bilateral comparisons as well as the determination of the proportion of skeletal and dental structures, individually and among themselves as a whole....

Báo cáo khoa học: "The adaptation of a machine-learned sentence realization system to French" potx

... albeit based on machine-learned models trained on French data.4 EvaluationWe performed a human evaluation of Frenchgeneration. This was the first formal evaluation of the French generation system. ... (199 8a) "The practicalvalue of n-grams in generation". In Proceedings of the 9th International Workshop on NaturalLanguage Generation, Niagara -on- the-Lake,Canada pp. 248-255.Langkilde ... Data and feature extractionThe data for all models are automaticallyextracted from of a set of 100,000 sentencesdrawn from software manuals. Between 30,000and one million cases are extracted...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... Santa Clara, CA, USA). Nebulization wasassisted by N2gas (99.8%) at a ﬂow rate of 10 LÆmin)1. Thespray chamber was held at 300 °C. The spectrometer wastuned using ﬁve calibration standards...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... 5¢-CGCGGATCCGCCCCTGTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGGATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢and ... to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T (2000) Molecularmechanism of the nacreous layer formation in Pinctadamaxima. Biochem ... 5¢-CGCGGATCCACCGTAGACACTTATGATATA-3¢ and5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢;rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGTGATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCTGTTAATGATGGAACC-3¢...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... thesame time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral ... GC, Katakura K, Tomita T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu ... bindingAzide, like imidazole, is a ligand with both r-donorand p-donor characteristics, but is a relatively stron-ger p-donor for stabilization of the higher oxidationstates of metal ions. In agreement...

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of speciﬁcity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... synchrotron beamtime at the Synchrotron Radiation Source, DaresburyLaboratory, for data collection, and for preliminarycrystal characterization at the European SynchrotronRadiation Facility, ... inter-action of C2-OH with Glu191 is essential, because thetautomerization step of the catalytic reaction requires a general acid to donate a proton to the C1 carbon of the 1,2-enediol, whereas ... [20] and identiﬁed a move-ment of the cofactor-binding domain of subunit A rela-tive to subunits B and C (not shown). This domainalteration involves a rotation of 5° and translation of 0.7 A ˚....

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... pyridinechromogen method [12]. The purity of the sample was greaterthan 97%, based on MALDI-TOF mass spectrometry.Preparation of monoclonal antibodiesMP8 was covalently attached to keyhole limpet hemo-cyanin ... 4962–4967.12. Aron, J., Baldwin, D .A. , Marques, H.M., Pratt, J.M. & Adams, P .A. (1986) Hemes and hemoproteins 1: preparation and analysis of heme containing octapeptide (Microperoxidase-8) and identi-ﬁcation ... abzymes; nitrosoalcanes;microperoxidase 8; S-oxidation.Catalytic antibodies with a metalloporphyrin cofactor, orÔhemoabzymesÕ, are not as efﬁcient a category of catalysts astheir natural hemoprotein...

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

... the action of aminoferase. Biokhimia 12, 556–568 (in Russian).2. Esaki, N., Nakayuma, T., Sawada, S., Tanaka, H. & Soda, K.(1985) Proton NMR studies of substrate hydrogen exchangereactions ... a- carboxylateand a- amino group in the external aldimine deﬁnesautomatically the positions of the a- proton and the sidechain of any bound amino ac id. The lability of the a- protonobserved for a large ... reaction pathway responsible for the principaltransformation.Values of KSHand kf(H)correspond to KDand kf for thereaction of nondeuterated substrate, and KSD, kf(D)andkr(D)are...

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... side chain and carbonyl oxygen of Asp9, the side chains of Asp12, Gln13, Asp19, the car-bonyl oxygen of Asn21 and one water molecule in a pentagonal bipyramidal manner (Fig. 4A) . Sequencealignments ... 6,501–523.50 Feller G, Payan F, Theys F, Qian M, Haser R &Gerday C (1994) Stability and structural analysis of alpha-amylase from the antarctic psychrophileAlteromonas haloplanctis A2 3. Eur J Biochem ... temperature adaptation. First,whereas the overall exposed surface areas of the psy-chro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of largerarea of...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... mitoDC-81 alkylates mtDNA in mitochondria or cells.The reasons for the lack of alkylation of mtDNAwithin mitochondria by mitoDC-81 are unclear. The localconcentrations of mitoDC-81 and DNA, and ... Preparation of mitochondria from animal tissues and yeasts. In Subcellularcomponents. Preparation and Fractionation (Birnie, G.D., ed.), pp.77–91. Butterworths, London.38. Gornall, A. G., Bardawill, ... alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent andshow that it alkylates...

Xem thêm