báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc
báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc
... using the Mann-Whitney U test, the adequate statistical valuesare the mean ranks and the sum of ranks. However, toimprove the comparability of the obtained results, dataare presented as means and ... withpatients seeking care at the TMD/Orofacial Pain Outpa-tient Clinic (TMD/OFPOC) at the same university. Weexamined sociodemographic data, self-reported somaticcomplaints, and psychological impairment. ... restoration or concern-ing the repair of a damaged or insufficient prosthodontic restoration, and the presence of dental pain.In addition, 134 patients seeking care at the TMD/OFPOC at the same university...
- 8
- 216
- 0
Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx
... (EBRT),brachytherapy (BRT), and intraoperative radiation ther-apy. Unfortunately, EBRT can cause growth retardation oradversely affect organ function in the pediatric popula-tion. Although randomized ... for citation purposes)Introduction A variety of radiotherapeutic approaches have been usedin the adjuvant local management of soft tissue sarcoma(STS). These include external beam irradiation ... and exter-nal beam irradiation compared to implant alone [1].Tumor size and anatomic location have been debated asimportant factors to be used to guide decisions regarding the use of radiation...
- 6
- 260
- 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... toemphasize what Streat and coworkers [15] termed, the largerisk of unacceptable badness’, rather than a vanishingly smallpotential for benefit.There are far worse things than death, and many of ... of them occurin ICUs when futility maxims are circumvented. There is a population of ICU patients who will die no matter whattreatment is rendered them. Medically inappropriate carecauses pain, ... tomanipulate it. Life support generates an outcome that isno longer inevitably fatal.4. Physicians do not have an exceptional track record inexplaining end -of- life issues to patients and their...
- 2
- 463
- 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx
... molecular basis for new therapeutic strate-gies targeting specific pathways to treat human heartdisease.Materials and methodsAnimalsNeonatal Wistar rats (1-3 days) were purchased from the Animal ... ª 2009 The Authors Journal compilation ª 2009 FEBSStatistical analysesData are presented as mean ± standard error of the mean(SEM) of the values obtained from the indicated number of independent ... end-stage congestive heart failure.Apoptosis is a highly regulated programme of celldeath and can be mediated by death receptors in the plasma membrane, as well as in the mitochondria andthe...
- 11
- 614
- 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... 2010 FEBSpantoate. The Nd atom of Asp152 is hydrogen-bondedvia one water molecule to the O3 atom of pantoate,and via two water molecules to the O4 atom of panto-ate. The Ne atom of His37 is ... is capable of binding both pantoate andATP, at equivalent sites in the dimer, which is the firststep of the bicatalytic–unicatalytic–unicatalytic–bicata-lytic mechanism. X-ray crystallographic ... consideration that a molecule of pantoate is bound in the ATP-bindingpocket in addition to its canonical binding site, andthat ATP displaces this molecule of pantoate.b-Alanine and pantothenate...
- 16
- 791
- 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R mRNA mut 3IL6R mRNA mut 2miR-2 3a miR-2 3a miR-2 3a 2531 ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA ... 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a 253120 A B18161412**10EGFP intensity86420EGFPEGFP-IL6R...
- 9
- 541
- 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt
... moleculeconsists of a long, partially unsaturated, aliphaticbackbone with spaced cyclic ethers and 64 chiralcenters. Examination of the structure shows that thereis, in fact, a group of different palytoxins, ... [7,8]. Italian coastsare not the only seawaters where Ostreopsis specieshave appear; they have been found in the watersaround Spain and Greece as well, indicating that the expansion in the Mediterranean ... (75 nM) and latrunculin -A (10 lM) treatments after 4 h of incubation.Arrows indicate the alterations on microvilli induced in latrunculin -A- treated cells.Palytoxin activity against the cytoskeleton...
- 8
- 691
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... andactivity of ervatamins, the papain-like cysteine proteasesfrom a tropical plant, Ervatamia coronariaRaka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta andSampa ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallizationand preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55, ... Biswas S, Chakrabarti C, Sundd M,Jagannadham MV & Dattagupta JK (2004) Structuralbasis of the unusual stability and substrate specificity of ervatamin C, a plant cysteine protease from Ervata-mia...
- 14
- 634
- 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf
... incubation with cofilin at pH 8.0 the rate and the extent of actin cleavage was the same in the presence and absence of 30 mm Pi. On the otherhand, at pH 6.5 the rate of F-actin cleavage wasinhibited ... vicinity of the barbed end of the filament, pro-ducing an ATP or ADP–Pi cap at this end. Because of the presence of this cap at the barbed end the criticalconcentration for polymerization of F-actin ... 6.5than at pH 8.0, yielding apparently greater inhibition of cofilin binding at pH 6.5 than at pH 8.0 (relative to the rate observed in the absence of Pi). However,another explanation of the stronger...
- 9
- 487
- 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... degradation pathway (Ganas and Brandsch,unpublished). Therefore, it is reasonable to assumethat pAO1 encoded AO and SsaDH have evolvedspecifically for the catabolism of CH3-4-aminobutyrateproduced ... Use15¢-GAG GTG GAT CCG TGG GCC GCA-3¢ Forward mao, cloning25¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ Reverse mao, cloning35¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ Forward sad, cloning45¢-CAT GTA AGC CCC ... Lustig A, EdmondsonDE & Mattevi A (2005) Three-dimensional structure of human monoamine oxidase A (MAO A) : relation to the structures of rat MAOA and human MAOB. Proc NatlAcad Sci USA 102,...
- 9
- 524
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ