0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx

Báo cáo y học:

Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx

... citation purposes)Journal of Medical Case ReportsOpen Access Case reportResolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: ... fibrosis and tubular atrophy. Following rehydration,chemotherapy and free light chain removal using high cut-off haemodialysis, free light chain concentrations fell to less than 5% of the starting ... wishes, haemodialysis was discontinued. Creatininelevel at this point was 650 μmol/litre.At 1 year after discontinuation of dialysis, the patient remains symptomatically well and the myeloma is in remission....
  • 5
  • 297
  • 0
Báo cáo y học:

Báo cáo y học: "Resolution of cell-mediated airways diseases Carl G Persson*1 and Lena Uller2" pps

... resolution of airway inflammation.Transepithelial egression of inflammatory cells at clinical improvement of airways diseaseEosinophils In animal models of allergic airway inflammation[11,13,26] airway ... Importantly, with a delay of about two hours also the nasal airway lumen mast cellsexhibited a progressive increase in numbers. As with many other aspects of nasal mucosal inflammatoryresponses ... drug-induced inhibition of transepithelial migration of airway wall leukocytes. It helps interpretation of common airway lumen data, and suggests approaches to treat cell-mediated airway inflammation.IntroductionMechanisms...
  • 12
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: " Resolution of LPS-induced airway inflammation and goblet cell hyperplasia is independent of IL-18 J Foster Harris1, Jay Aden1, C Rick Lyons2 and " doc

... analyzedusing a two-way analysis of variance (ANOVA); valuesthat were considered significantly different from eachother by ANOVA were further analyzed using a post-hocTukey's t test. Data having ... lev-els of chemokines and cytokines in the BALF that havebeen reported to be important in recruiting and activatinginflammatory cells to the airways and those that play a role in mucin synthesis and ... similar in both proximal (airway generation 5) and distal (airwaygeneration 11) airways.Non-mucus cells per millimeter basal lamina (BL)remained statistically unchanged with approximately 90–120...
  • 12
  • 227
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

... identified 1 gastric and 1 colon cancer patient in our study. An early gastric cancer was di-agnosed on biopsy of a suspicious ulcerated area in a 45-year-old man patient. Partial gastrectomy was su ... of ab -dominal pain, abdominal pain with hungry and an -xiety, abdominal distension, nausea, vomiting, poor appetite and symptoms of gastroesophageal reflux. All patients were graded 1 to ... their family. At ad-mission, significant physical examination findings of 91 patients; 2 had hepatomegaly, 1 had splenomegaly and 8 had epigastric sensitivity (Table 2). 18 of 89 patients had...
  • 9
  • 425
  • 1
Báo cáo y học:

Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"

... evaluation of liposomal chloroquine diphosphate loaded by a transmem-brane pH-gradient method. Int J Pharm. 2008; 361:56-63. 22. Maitani Y, Aso Y, Yamada A, et al. Effect of sugars on storage ... (Sigma-Aldrich) was added to each well. Finally, the absorbance of each well was meas-ured at 570 nm. All MTT assays were repeated two times. The relative growth rate was calculated as A5 70 ... Statistical analysis The SAS statistical software was used for statis-tical analyses. The results are expressed as the means ± standard deviations, and samples were subjected to multiple analysis of...
  • 12
  • 635
  • 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

... complex of lactoferrin with a lanthanide ion (Sm3+)at3. 4A ˚resolution. Acta Crystallogr. D55,1799–1804.36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti-tative image analysis ... solution was prepared by mixing YbCl3andapo-Tf solutions in a molar ratio of 2.5 : 1 and the free Ybwas removed by ultrafiltration. As indicated in the Resultssection, with this molar ratio apo-Tf ... lM.Itisonly30%saturatedwithironinbloodplasmaand has the capacity for binding to other metal ions of therapeutic and diagnostic interest [16]. Therefore, it hasbeen suggested that Tf can act as a nature...
  • 9
  • 385
  • 0
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

... that cyclosporin A (CsA), vinblastine, and valinomycin (and several otherdrugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo´Jr,unpublished data)1interactwithPgpinsuchamannerthatpreincubation ... at 37 °C in an incubator containing 5%CO2and maintained by regular passage in Dulbecco’sminimal essential medium (supplemented with 10% heat-inactivated fetal bovine serum, 2 mML-glutamine ... phenomenoninvolving UIC2 and MM12.10 mAbs [22] were affected by pharmacological modulation of the ATPase cycle in a parallel manner. Near the catalytic transition state stabilized by Vior BeFx, Pgp apparently...
  • 6
  • 590
  • 0
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc

Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc

... Antibodies: A laboratory Manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork.37. Kohsaka, T., Takahara, H., Sasada, H., Kawarasaki, T., Bamba,K., Masaki, J. & Tagami, S. ... transportedselectively from the Golgi apparatus toward the apicalsurface of granulosa cells, which are apposed to the PL. In polarized Madin–Darby canine kidney cells, the O-glyco-sylated domain has critical ... Hatsuzawa,K., Ikemizu, J., Murakami, K. & Nakayama, K. (1991) Arg-X-Lys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within the constitutive secretory pathway. J. Biol. Chem....
  • 9
  • 300
  • 0
Báo cáo y học:

Báo cáo y học: "Effect of increasing intraperitoneal infusion rates on bupropion hydrochloride-induced seizures in mice" pptx

... study, the animals were maintained in a facility fully accredited by the Standards Council of Can-ada (SCC) and the care and use of the animals was con-ducted in accordance with the guidelines ... in the hazard (probability) of a mousehaving a convulsion when the infusion rate increases by 1min. This hazard ratio is consistent with the odds ratioobtained by logistic regression analysis ... cage cardindicating group, animal number and sex. All animalswere acclimated to their cages and to the light/ dark cyclefor a period of 7 days prior to surgery and for at least 1additional...
  • 7
  • 463
  • 0
Báo cáo y học:

Báo cáo y học: "Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reacti" potx

... ProbeADAMTS5 TGGGTTCCCAAATATGCAG CTGTCCCATCCGTCACCT CTGGGAGA1AGC1 GGGACCTGTGTGAGATCGAC GTAACAGTGGCCCTGGAACT AGGAGCTGBGN CAGAACAACGACATCTCAGAGC TCACCAGGACGAGAGCGTA CTCCACCACOL 1A2 CTATCAATGGTGGTACCCAGTTT ... ACTCTGGGATCACGCATGT CTGCCTTCLUM ACCTGGAAATTCTTTTAATGTATCATC CGGTATGTTTTTAAGCTTATTGTAGGA TGCTGGAGMMP13 CCGCGACCTTATCTTCATCT AACCTTCCAGAATGTCATAACCA AGAGGCAGRPL1 3A CTGCCCCACAAGACCAAG GGGATCCCATCAAACACCT ... ATGGGCTGTGAGTGCAAGAT CACTCATCCGGAGACGAGAT CTGCCCCATIMP4 GCAGAGAGAAAGTCTGAATCATCA GGCACTGTATAGCAGGTGGTAA TGTGGCTGTNC TGGATGGGACAGTCAAGGA GCTCAGCTCTGCCAGGTTA CCACCTCCVIM TACAGGAAGCTGCTGGAAGG CCTCAGGTTCAGGGAAGAAA...
  • 9
  • 386
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ