0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

báo cáo khoa học:

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

... HCVtransmission risk behaviours include injecting drugs, the sharing of injecting equipment, not cleaning and reusing drug paraphernalia, alcohol misuse, cocaine use, unpro-tected sexual activity, ... expectancies (expected con-sequences of a course of action, e.g. sharing injecting equipment) and self efficacy (confidence in one's abilityto achieve a particular goal, e.g. avoidance of ... marginally effective at reducing HCVincidence and limited evidence evaluating the effective-ness of behavioural interventions in reducing its inci-Table 4: Changes in risk behaviour and alcohol...
  • 12
  • 454
  • 0
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... malonyl-CoA, catalyzed by ACC – the key reg-ulatory enzyme in the pathway. Malonyl-CoA serves as the basic chain-elongating substrate for the formation of long-chain saturated fatty acids catalyzed ... increase in malonyl-CoA promotes a decrease in neuropeptide Y and agouti related peptide in hypo-thalamic malonyl-CoA while promoting an increase in proopiomelanocortin and cocaine and amphetamineregulated ... mediatechanges in feeding behavior and body weight. ACC, acetyl-CoA car-boxylase; AMPK, 5¢ AMP kinase; CPT, carnitine palmitoyltransfer-ase; FAS, fatty acid synthase; MCD, malonyl-CoA decarboxylase;OAA,...
  • 7
  • 678
  • 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... rubripes;Brare, Danio rerio; Anoga, Anopheles gambiae; Drome,Drosophila melanogaster; Sacce, Saccharomyces cerevisi-ae; Schizo, Schizosaccharomyces pombe; Ciona, Cionaintestinalis; Caeel, Caenorhabditis ... variants of various lengths; each variantencodes distinct protein domain architectures thatshare a canonical bipartite nuclear localization signal and a PHD domain (Zn finger) at the N-terminalregion. ... (Fig. 1), in which the SPP1 representatives are at the basal branch of CGBP and DIO. The GCBP proteins contain a PHD domain, fol-lowed by a DNA-binding domain (the zf-CXXC) and the newly described...
  • 7
  • 658
  • 0
Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

... a surface with several convex and concave areas as indicated by a , ÔbÕ and c , which participate in subunit association. Two neighboring subunits (A and B) associated in a tail-to-head manner ... lMprotein concentration.(B) The dynamic quenching constant (KSV) and the fractional maxi-mum accessible protein fluorescence (f a ) verses GdnHCl. The intrinsicfluorescence of duck d-crystallin (0.24 ... Self-Associating Systems in the Analytical Ultracentrifuge, Beckman Instruments, California.26. Chamberlain, A. K. & Marqusee, S. (2000) Comparison of equi-librium and kinetic approaches...
  • 8
  • 426
  • 0
Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

... that accu-mulates in castor beans (Ricinus communis). The mature ricin comprises a catalytic A chain and a Bchain linked by a single disulfide bond. The ER-tar-geted A chain is degraded by a ... isinhibited by the proteasome inhibitor clasto-lactacystinb-lactone, resulting in the accumulation of ricin A chains. These stabilized ricin A chains are partlydeglycosylated by a peptide–N-glycanase-like ... of cDNA clones encodingplant calreticulin in barley. Plant Cell 6, 835–843.146 Huang L, Franklin AE & Hoffman NE (1993) Primary structure and characterization of an Arabidopsis thali-ana...
  • 20
  • 438
  • 0
Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

... acids with branched carbon chain:Thus, the catalytic action of the 2-oxo acid dehydro-genase complexes directly in uences the NADH/NAD+ratio and involves the important biological SH/S-S com-pounds, ... CoA-induced inactivation, as the thioredoxin effect is related to alleviation of thisinactivation. On the other hand, among 11 thioredoxinspecies with comparable activity in the nonspeci c insulinreduction ... onlyreaction of substrate phosphorylation in the Krebs cycle,catalyzed by succinyl thiokinase. This may be especiallyimportant in cases where leakage of pyridine nucleotides oraccumulation of NADH...
  • 7
  • 407
  • 0
Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

... oligonucleotides were con-structed: S1-SDH1, 5¢-ATGCTATCGC TAAAAAAATCAGCGCTCTCC AAGTTGACTT TGCTCAGATT CGTACGCTGC AGGTCGAC-3¢; and S2-SDH1, 5¢-TTAGTAGGCT CTTACAGTTG GAGGTACGGA AGGACATTCC TTTTCGTCCA ... (5¢-TGCAATTAAA GAAGAGTATG ATATTCTTTT CCGTAAAATA CAATGAG-GTT CAAAGCATAG GCCACTAGTG GATCTG-3¢). The WT and EBY167-G418Sstrains were transformed using the LiAc ⁄ SS Carrier DNA ⁄ PEG method as ... regions to the end of the SDH1 locus. For thispurpose, two primers were constructed: S1-SDH1-HA(5¢-TTTGGACGAA AAGGAATGTC CTTCCGTACCTCCAACTGTA AGAGCCTACG CCGGTGCTGG ATCCGGT-3¢); and S2-SDH1-HA (5¢-TGCAATTAAA...
  • 15
  • 407
  • 0
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

... using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagccgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaatacggctgttc), ... (5¢-tacccatgtagtcgcagcgatcgttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaaggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respec-tively. In order to combine all four mutations, ... from the genomic DNA of Bacillus brevis ATCC 9999using the primers P1 (5¢- tatccatggtaaacagttctaaaagtatattg) and P2 (5¢- tatagatctctcacttcttcttttactatc). The PCR productwas subcloned into a pQE60...
  • 13
  • 493
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Hardness and basic density variation in the juvenile wood of maritime pine" ppt

... V). Calculating the regressionswith the mean value of each tree in eachsentative of the second thinning in current man-agement practices. Both stands were located at the ... real latewood and a higher intra-ringhomogeneity) and which can induce a dif-ferent behaviour during the indentation of the tool. It was again in these inner ringsthat ... (table I).Formula 3 was also used to calculate the effects in each tree, by using the means in the tree instead of the means in the whole class, sothat, finally, the...
  • 13
  • 468
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

... in the analysis. DV participated in the coordination. CG and TK conceived of the study, and participated in its design and coordination. All authors have approved the final manuscript. Acknowledgements ... squamous cell carcinoma of the head and neck were included in a prospective, non -randomised clinical study. These patients represent a cross-section of all patients receiving bilateral irradiation ... Oral Oncol 2009, 45: 505-510. [27] Lacatusu S, Francu L, Francu D: Clinical and therapeutical aspects of rampant caries in cervico-facial irradiated patients. Rev Med Chir Soc Med Nat Iasi 1996,...
  • 25
  • 342
  • 0

Xem thêm

Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam