báo cáo khoa học: " Retail promotions and perceptions of R J Reynolds’ novel dissolvable tobacco in a US test market" pdf
báo cáo khoa học: " Retail promotions and perceptions of R.J. Reynolds’ novel dissolvable tobacco in a US test market" pdf
... Study find-ings also suggest that promotions, especially thoseaimedattrial(i.e .in- storeadsandin-barpromotions)play a major role in creating awareness and producttrial. In- store and bar promotions ... astargeting smokers. However, consumer awareness of Camel Dissolvables during test marketing was very low;males and current and former smokers had greaterawareness, interest and trial of the products.MethodsThe ... sample characteristics, rates of aware-ness and trial for Camel Dissolvables and likelihood of Table 1 Camel Orbs, Strips & Sticks Retail Point -of- Purchase Promotions Characteristic %Incidence...
- 10
- 319
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... 3¢-end of HCVminus-strand RNA as they were also present whenRNA fragments of the 3¢UTR were used as templates.Data from RdRp assays performed in the presence of heparin indicated that these products ... provided by A. Martin (Institut Pasteur, Paris,France). The primers used were VB1: 5¢-AAACATATGAGCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCGAGCTTCACAAGAAACTTCTGC-3¢. The PCR fragmentwas cleaved ... synthesizes a minus-strandRNA that serves as a template for the synthesis of new plus-strand RNA molecules. Initiation of RNAsynthesis at the 3¢-end of the plus- and minus-strandRNA most probably involves...
- 15
- 597
- 0
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx
... International randomizedstudy of interferon versus STI571 (IRIS) 7-year follow-up:sustained survival, low rate of transformation and increasedrate of major molecular response (MMR) in patients ... therapies,dasatinib and nilotinib, are available for CML patientswho are resistant to or intolerant of imatinib therapy.Although the newer TKIs are similar, there are differences in their side-effects ... Nilotinib prescribing information 2007 [http://www.pharma .us. novartis.com/product/pi /pdf/ tasigna .pdf] . East Hano-ver, NJ: Novartis Pharmaceuticals Corporation14. Dasatinib prescribing information 2009...
- 6
- 337
- 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
... at zero time (100%).Error bars are standard deviations for data from three separateexperiments. Asterisks indicate error bars representing mean ±one-half the range from two separate experiments. ... 240-min data are from a single experiment, and error bars represent range of duplicate determinations. Errorbars in 60-min curves represent mean ± one-half the range fromtwo independent experiments, ... and neuronal differentiation. Proc Natl Acad SciUSA 100, 928–933.3 Zaid A, Roubtsova A, Essalmani R, Marcinkiewicz J, Chamberland A, Hamelin J, Tremblay M, Jacques H,Jin W, Davignon J et al....
- 13
- 712
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... CGAGCAGGAGATGGGAACC Real-time PCRZfbactin -R CAACGGAAACGCTCATTGC Real-time PCRZfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCRZfgapdh -R TCAGCAACACGATGGCTGTAG Real-time PCRZFil4-F CATCCAGAGTGTGAATGGGA Real-time ... 5¢-RACEZf5¢stat6 -R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet -R1 ... CTGCTTTTCTGGGGACTTCA Initial PCRZf3¢foxp3-F1 TGAAGTCCCCAGAAAAGCAG 3¢-RACEZf3¢foxp3-F2 GTGCTTTGTGCGTGTTGAAG 3¢-RACEZf5¢foxp3 -R1 TGTATGATGGAAAAGGTGGCA 5¢-RACEZf5¢foxp3 -R2 GGAACACACAGAGGGGATGATA 5¢-RACEOligo...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-CATGG-3¢ were used for detecting ... b-conglycinin and glycinin,as pro-b-conglycinin and proglycinin are transient pro-tein forms that are present in the ER prior to process-ing in the protein storage vacuoles. The synthesis of proglycinin ... and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Japan2 National Agricultural Research Center for Hokkaido Region, Sapporo, JapanIntroductionSecretory, organelle and...
- 12
- 622
- 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt
... M,Kumadaki S, Matsuzaka T, Nakagawa Y, Yahagi N,Nakakuki M, Hasty AH et al. (2008) Palmitate impairs and eicosapentaenoate restores insulin secretion throughregulation of SREBP-1c in pancreatic islets. ... development of ventricular arrhythmia, especiallyafter myocardial infarction, could be regulated bymyocardial SREBP-1c, indicating a relationshipbetween lipid metabolism and the parasympatheticresponse ... that may play a role in arrhythmogenesis.Regulation of sulfonylurea channels and other potas-sium channels by SREBPs was also observed in ourpreliminary evaluation of SREBP-1c-overexpressingb-cells,...
- 6
- 574
- 1
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... binding of ligand to a type II receptor, a transmembranous serine ⁄ threonine receptor kinase.The ligand–type II receptor complex recruits anotherserine ⁄ threonine transmembrane receptor kinase, ... GrowthFactor Rev 12, 305–312.12 Beall MJ & Pearce EJ (2001) Human transforminggrowth factor-beta activates a receptor serine ⁄ threoninekinase from the intravascular parasite Schistosoma man-soni. ... day para-sites, adult worm pairs, separated adult female and male worms, and eggs. cDNA from uninfected B. glabrata snails served as a neg-ative control. J. M. Carlo et al. SmSmad1B, a BMP -R- Smad...
- 19
- 653
- 0
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc
... amonghubs are retained.AcknowledgementsThanks to Dr J. Aldana-Montes and members of Kha-os group research of the University of Ma´laga for theirhelp in data acquisition. Thanks to P. Fernandez and S. ... bindingfactors involved in the NFjB pathway and other func-tional related factors, such as p300 and CBP. GroupD contain factors related to cell cycle and DNArepair-related factors (p53 and ... proteininteraction; tinkering; transcription factornetworkCorrespondenceRicard V. Sole´, ICREA - Complex SystemLaboratory, Universitat Pompeu Fabra,Dr Aiguader 80, 08003 Barcelona, SpainFax:...
- 12
- 511
- 0
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx
... lowviscotoxin concentration as concentrations greater than1 lm always led to seal breakdown. Pyrularia thionin and b-purothionin are also capable of lysing cell mem-branes, indicating that thionins in ... fluxes of Ca2+ in Neurospora crassa hyphae[42]. We found that VtA3induced an increase in internalCa2+concentration, this Ca2+probably being liberatedfrom internal stores. We were able ... cellular targets and the mechanism of action of vis-cotoxins, by examining the interaction of VtA3withfungal cells. We describe a detailed investigation of thecellular and signalling characteristics...
- 12
- 530
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ