Báo cáo y học: "Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report" doc
Báo cáo y học: "Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report" doc
... reportOpen AccessChest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case reportNobuyasu Suganuma*, Nobuyuki Wada, ... Hiromasa Arai, Hirotaka Nakayama,Keita Fujii, Katsuhiko Masudo, Norio Yukawa, Yasushi Rino,Munetaka Masuda and Toshio ImadaAddress: Department of Surgery, Yokohama City University Hospital and ... kfujii@med.yokohama-cu.ac.jp; KM - masudo@urahp.yokohama-cu.ac.jp; NY - yukawa@med.yokohama-cu.ac.jp;YR - rino@med.yokohama-cu.ac.jp; MM - mmasuda@med.yokohama-cu.ac.jp; TI - timada@urahp.yokohama-cu.ac.jp*...
- 4
- 172
- 0
Báo cáo y học: "Chest wall mechanics during pressure support ventilation" ppsx
... EC and DC performed the study and carried outdata collection. AA, PP and LG drafted the manuscript. AA and EC performed the statistical analysis. AA, PP, RD, AP and LG conceived the study and ... rib cage muscles and expiratory action of theabdominal muscles; and the phase shift between rib cage and abdominal compartments.Ventilatory pattern, gas exchange and respiratory effortThe pattern ... Ourdata suggest that respiratory rate and tidal volume changesare good bedside indicators of WOB and respiratory drive, and therefore we believe that f/Vt may be considered an indi-cator of adequacy...
- 10
- 304
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13]. This method recorded COP data and analysed COP traces using an image analyser ... an unhealthy or less desirable control strategy. The analysis of fractal patterns in gait and posture data may serve as an indicator of pathology or impairment. Surrogate data analysis is used ... Blaszczyk and Klonowski [10] performed a non-linear analysis of 12 healthy elderly participants’ COP data and found that a fractal dimension analysis, using Higuchi’s algorithm revealed a difference...
- 10
- 457
- 0
Báo cáo y học: "Simultaneous sleep study and nasoendoscopic investigation in a patient with obstructive sleep apnoea syndrome refractory to continuous positive airway pressure: a case report" ppt
... had low alcohol consumption (10 gr/day) and no history of smoking. A physical exam revealedmacroglossia, a bulky soft palate and uvula. He wasoverweightwithabodymassindex(BMI)of29. 1and had a ... upper airway surgery (especially bi-maxi llary advancement) may also be considered. Case presentation: We report the case of a 38-year-old Caucasian man with severe obstructivesleep apnoea syndrome, ... positive airway pressure:acasereportClaudia Chaves Loureiro*1, Marta Drummond2, Adriana Magalhães2,Elisabete SantaClara2, Miguel Gonçalves2 and João Carlos Winck2Addresses:1Department...
- 7
- 359
- 1
Báo cáo y học: " Symptoms of epilepsy and organic brain dysfunctions in patients with acute, brief depression combined with other fluctuating psychiatric symptoms: a controlled study from an acute psychiatric department" potx
... acute psychiatric condi-tions are admitted each year. Norwegian acute psychiatricservices are public and available to everyone. All thepatients in the catchment area are admitted to this depart-ment. ... cerebelli.At clinical neurological examination, three AUDS patients and one control patient had signs of CNS pathology. OneAUDS patient had ophtalmoplegia and bilaterallyinverted plantar reflexes ... abuse. All patients hadurine and blood screens, assessing substance abuse and medication, and EEG was performed shortly after admit-tance.The small number of subjects leading to relatively weakstatistical...
- 6
- 279
- 0
Báo cáo y học: " Serodiagnosis of sheeppox and goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32" ppt
... μgAand0.1μg B). The optimal antibody* Correspondence: hnxiangtao@163.comKey Laboratory of Animal Virology of Ministry of Agriculture, State KeyLaboratory of Veterinary Etiologic Biology, Lanzhou ... specificity and sensitivity. The a ssay also had good repeatability and promises to be useful in clinical contexts.In summary, the I-ELISA established here was sensi-tive and specific for SPPV and ... scale.Materials and methodsSerum samples20 positive sera (isolated from naturally infected sheep and goats) were provided by the State Key Laboratory ofVeterinary Etiological Biology Lanzhou...
- 4
- 323
- 0
Báo cáo y học: "Extra-cellular release and blood diffusion of BART viral micro-RNAs produced by EBV-infected nasopharyngeal carcinoma cells" pps
... plasma samples. BV, JG, PL and ST participated in the collection of clinical samples. VS and CA have assayedviral DNA load in plasma samples and assessed anti-VCA and -EBNAantibodies. SB has ... with a rat monoclo nalantibody (Stressgen, Ann Harbor, MI) and b-actin wasvisualized using a monoclonal antibody (AC-74) fromSigma Aldrich (St. Louis, MO).Collection, separation and storage ... Gilligan KJ, Rajadurai P, Lin JC, Busson P, Abdel-Hamid M, Prasad U, Tursz T,Raab-Traub N: Expression of the Epstein-Barr virus BamHI A fragment innasopharyngeal carcinoma: evidence for a viral...
- 12
- 341
- 0
Báo cáo y học: " Full genome comparison and characterization of avian H10 viruses with different pathogenicity in Mink (Mustela vison) reveals genetic and functional differences in the non-structural gene" pot
... ATATCGTCTCGTATTAGTAGAAACAAGGCATTTPA PA-F1 TATTCGTCTCAGGGAGCGAAAGCAGGTACPA-R1 TNGTYCTRCAYTTGCTTATCATPA-F2 CATTGAGGGCAAGCTTTCPA-R2 ATATCGTCTCGTATTAGTAGAAACAAGGTACTTHA HA-F1 GCAAAGCAGGGGTCACAATGTCAHAR1 ... TCTGAATCAGCCATGTCAATTGTHA-F2 GATTTCCATTGGACGATGGTACAACCAHA-R2 GGGTGTTTTTAACTAAATACAGATTGTGCNP NP-1F AGCRAAAGCAGGGTDKATANP-1R CYARTTGACTYTTRTGTGCTGGNP-2F TAYGACTTTGARAGAGAAGGNP-2R AGTAGAAACAAGGGTATTTTNA ... AGTAGAAACAAGGGTATTTTNA N4-F AGCAAAAGCAGGAGTTTCATAATGAN4-R CATGGCCCGATGGCGCTCTGTTGN7-F GTGATCGAGAATGAATCCAAATCAGAN7-R GCATTTTACGAAAAGTATTGGATTTGM M-F AGCRAAAGCAGKTAGM-R AGTAGAAACAAGGTARKTTTTNS...
- 11
- 392
- 0
Báo cáo y học: "Bone mineral density and body composition in postmenopausal women with psoriasis and psoriatic arthritis" doc
... and femur BMD and fat mass after treat-ment with etanercept and infliximab in AS patients [19].Saraceno and Gis ondi demonstrated an increase of bodyweight in Ps and PsA patients treated with ... MMP participated in study design, analyzed bonescan DXA as well as spine X-ray for radiographic fractures, interpreted and analyzed the data and helped to draft the manuscript. VLS participated ... HC and Brazilian population over 40 years old [42].Sinigaglia et al. found an association among fracture and advanced age, disability, more prolonged disease and more severe disease activity...
- 7
- 345
- 0
Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt
... Sweden, and forms the basis for ANSWER. In the studied six EDs,Monday was the busiest and Sa turday the least busyday. All EDs had a large increase in patient inflo wbefore noon and a slow ... conception and design of the study, datainterpretation and critically revised the manuscript. FE and PT collected and analyzed the data and critically revised the manuscript. FE also drafted themanuscript. ... http://www.dh.gov.uk/en/Publicationsandstatistics/Statistics/Performancedataandstatistics/AccidentandEmergency /index.h tm],Accessed February 2, 2011 14. Accident and Emergency Attendances in England 2009-10. NationalHealth Service, The Health and...
- 10
- 270
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ