Báo cáo y học: "Helping someone with problem drinking: Mental health first aid guidelines - a Delphi expert consensus study" pdf
Báo cáo y học: "Helping someone with problem drinking: Mental health first aid guidelines - a Delphi expert consensus study" pdf
... Survey Initiative. World Psychiatry 2007:17 7-1 85.7. Kitchener BA, Jorm AF: Mental Health First Aid Manual Canberra: Cen-tre for Mental Health Research, The Australian National University;2002. ... drinking: Mental health first aid guidelines - a Delphi expert consensus studyAnna H Kingston, Anthony F Jorm, Betty A Kitchener, Leanne Hides, Claire M Kelly, Amy J Morgan, Laura M Hart and ... clinicians). The age of consumers and carers rangedfrom 1 8-6 0+ years (median age category was 5 0-5 9 years),while the age of clinicians ranged from 3 0-6 0+ years(median age category was 4 0-4 9 years).Once...
- 7
- 194
- 0
Báo cáo y học: " Helping someone with problem drug use: a delphi consensus study of consumers, carers, and clinicians" pptx
... the early help provided to some-one developing a mental disorder, as well as assistanceduring mental health crisis situations. The MHFAprogram teaches first aid for a variety o f mental health problems, ... Girolamo G,Fayyad J, Gureje O, Haro JM, Huang YQ, et al: Delay and failure intreatment seeking after first onset of mental disorders in the World Health Organization’s World Mental Health Survey ... Psychiatry 2008, 8: 1-1 0.11. Kelly CM, Jorm AF, Kitchener BA, Langlands RL: Development of mental health first aid guidelines for suicidal ideation and behaviour: a Delphi study. BMC Psychiatry...
- 7
- 361
- 0
Báo cáo y học: "Personal stigma and use of mental health services among people with depression in a general population in Finlan" ppt
... esa.aromaa@vshp.fi1Vaasa Hospital District and National Institute for Health and Welfare,Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, FI- 65320,FinlandFull list of author ... [31,32]. Finally, social desir-ability may always have an effect on attitude question-naires. People are likely to underreport their stigmatizingstereotypes compared with their real -life behavior. ... self management” and that m any p eople areafraid of all kinds of dependence - also in therapeuticrelationships. On a primary health care level, the role ofattitudes towards antidepressants...
- 6
- 298
- 0
Báo cáo y học: "Mimotopes selected with neutralizing antibodies against Multiple Subtypes of Influenza A" pot
... sequence and nucleotide sequence of multi-mimotope of influenza A E T K A W W L G S G G S Q A H N W Y N H K P L P G S G gaaactaaagcatggtggctgggttctggtggttctcaggctcataactggtataaccataagccactgccaggttccggt ... Ph.D. -7 , Ph.D. -1 2 and Ph.D. -C7C peptide phage-display libraries. a: Phage clones from Ph.D. –7 peptide phage-display library. b: Phage clones from Ph.D. –12 peptide phage-display library; c: ... Smith CB, Emery SL, Hillman MJ, Rivailler P, Smagala J, de Graaf M, Burke DF, Fouchier RA, Pappas C, Alpuche-Aranda CM, López-Gatell H, Olivera H, López I, Myers CA, Faix D, Blair PJ, Yu C, Keene...
- 25
- 206
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... erik.zakariassen@isf.uib.no1National Centre for Emergency Primary Health Care, Uni Health, Bergen,Norway, Kalfarveien 31, 5018 Bergen, NorwayZakariassen et al. Scandinavian Journal of Trauma, ... possibleNACA 5 Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... indicates need of hospitalisation, butstill not a life-threatening situation. NACA 4-6 indi-cates potentially (4) and definitely life-threateningmedical situations (5 and 6) and NACA 7 is a deadperson....
- 9
- 784
- 0
Báo cáo y học: "Can physical activity improve the mental health of older adults" pps
... Medicine and Pharmacology, University of Western Australia, Perth, AustraliaEmail: Nicola T Lautenschlager - nicolal@cyllene.uwa.edu.au; Osvaldo P Almeida - osvalm@cyllene.uwa.edu.au; Leon ... Flicker - leon.flicker @health. wa.gov.au; Aleksandar Janca* - ajanca@cyllene.uwa.edu.au* Corresponding author AbstractThe world population is aging rapidly. Whilst this dramatic demographic change ... this area clearly demon-strates that a major aim of PA programs is not just decreas-ing mortality, but also decreasing morbidity i.e. 'addinglife to years' and not just 'years...
- 5
- 544
- 0
Báo cáo y học: "Optimal search strategies for identifying mental health content in MEDLINE: an analytic survey" ppt
... strategies that can help dis-criminate the literature with mental health content fromarticles that do not have mental health content. Generalpractitioners, mental health practitioners, and researcherswanting ... PsychiatryOpen AccessPrimary researchOptimal search strategies for identifying mental health content in MEDLINE: an analytic surveyNancy L Wilczynski*1, R Brian Haynes1,2 and Team HedgesAddress: ... clinically relevant arti-cles can have a profound impact on searching.The example used in this paper is for retrieving high qual-ity treatment papers with mental health content. Treat-ment was...
- 7
- 396
- 0
Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx
... Center andhead of the electroconvulsive therapy unit of the Beer Ya’akov Mental Health Center. PD is paid by by Beer Ya’akov Mental Health Center. YR works as a research consultant for Brainsway.Competing ... Beer Ya’akov Mental Health Center and is paid by the research fund of the Beer Ya’akov Mental Health Center. KM serves as the director of the Beer Ya’akov Mental Health Center. ZA works at the ... Neuropsychiatry 2008,13:16 6-1 79.2. Tranulis C, Sepehry AA, Galinowski A, Stip E: Should we treat auditoryhallucinations with repetitive transcranial magnetic stimulation? A metaanalysis. Can J Psychiatry...
- 6
- 484
- 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... interval; CIITA = class II transactivator; CRP = C-reactive protein; GGP = geranylgeranyl pyrophosphate; HMG-CoA = 3-hydroxy-3-methylglutaryl-coenzyme A; HUVEC = human umbilical-vein endothelial ... Hakamada-Taguchi R, Uehara Y, Kuribayashi K, Numabe A, SaitoK, Negoro H, Fujita T, Toyo-oka T, Kato T: Inhibition of hydrox-ymethylglutaryl-coenzyme a reductase reduces Th1 develop-ment and ... statins arecurrently available within the UK: pravastatin, simvastatin,fluvastatin, atorvastatin and rosuvastatin; in addition,lovastatin is available in other countries. Cerivastatin hasbeen withdrawn...
- 7
- 334
- 0
Báo cáo y học: "Insulin resistance, adiponectin and adverse outcomes following elective cardiac surgery: a prospective follow-up study" docx
... insulin resistance nor adiponectin were statistically significantly associated with 30-day mortality,but adiponectin was associated with an increased 3 1-3 65-d ay mortality (adjusted odds ratio 2.9 ... Shimomura I, Sata M, Arita Y, Nishida M, Maeda N, Kumada M,Okamoto Y, Nagaretani H, Nishizawa H, Kishida K, Komuro R, Ouchi N,Kihara S, Nagai R, Funahashi T, Matsuzawa Y: Role of adiponectin inpreventing ... HOMAand adiponectin as continuous variables in an addi-tional spline regression analysis in order to identify anynon-linear patterns. A two-tailed p-value less than 0.05was considered statistically...
- 9
- 271
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ