Báo cáo y học: "Database analysis of children and adolescents with Bipolar Disorder consuming a micronutrient formula" pot

... et al.: Database analysis of children and adolescents with Bipolar Disorder consuming a micronutrient formula.BMC Psychiatry 2010 10:74.Submit your next manuscript to BioMed Central and take ... that it w as a database analysis, there aremany other variables we cannot control for such as use of other nonpharmacological treatments such as psy-chotherapy, change in diet and nutritional ... tolerability in pediatric and adult patients with bipolar Imania: A comparative analysis of acute, randomized, placebo-controlledtrials. Bipolar Disord 2010, 12:116-141.13. Biederman J, Hammerness...

Báo cáo y học: "Intensive intervention for children and adolescents with autism in a community setting in Italy: a single-group longitudinal study" ppsx

... progress and organize tasks, graphicalaids and sequential graphic agendas of work are used.Data are graphed to provide visual pictures of what ishappening with each skill and each maladaptive beha-viour ... upstudies of children with autism have shown that aggra-vation of symptoms or deterioration in behaviour mayoccur in at least an half of children around the time of puberty and early adolescence ... obviousthat the analysis of satisfaction in the first two years of activity may provide only a broad illustration, as it islikely biased by a favourable effect related to the positiveimpact of new...

Báo cáo y học: "Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome" pdf

... remaining sitesATCAGCGGTAATGA CATAGGGATATCAGC GGTAATGA CATAGGGAAATCAGC GGTAATGA CATAGGGATATCAGC GGTAATGA CATAGGGAAGSSGSSGSS GSSSNP A- genome A- genomeB-genomeATCAGC GGTA TGA CATAGGGATAATCAGC ... phenotypicvariation that eventually can play a critical role in the origin of new adaptations and important agronomic traits.BackgroundComparative analysis of grass genomes reveals a com-plex ... cycles of PCR in a 50-μl reaction mixcontaining 0.4 μM primer -A (CAAGCAGAAGACGG-CATACGAGCTCTTCCGATCT), 0.4 μM primer-B(AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTTC CGATCT) and 25 μlPhusion...

Báo cáo y học: "Proteome analysis of schizophrenia patients Wernicke''''s area reveals an energy metabolism dysregulation" potx

... corresponding spots were matched for all2-DE profiles. The spot volumes were analyzed byKruskal-Wallis one-way analysis of variance aiming toreveal the statistically significant differences ... detection and pI/MWcalibration of WA samples using the ImageMaster 2D soft-ware, (GE Healthcare, Uppsala, Sweden). A total of thirty2-DE profiles were analyzed, consisting of 27 gels frompatients ... 2-DE analysis and mass spectrometry. CWT provided guid-ance for the mass spectrometry and western blot analysis and contributed to the manuscript writing. SM and EDN (A) Western-blot profiles of...

Báo cáo y học: " Functional analysis of human and chimpanzee promoters" docx

... using a multi-way ANOVA includingspecies, clones, and replicates.Additional data filesAdditional data is available with the online version of thispaper. Additional data file 1 is a table listing ... promoter analysis were selected on the basis of a large-scale transcriptome comparison between three humans and three chimpanzees in brain and liver using AffymetrixHG U9 5A and HG U95Av2 arrays [6]. ... Out of a total of 71genes satisfying the gene-expression-based criteria (see Addi-tional data file 1), 35 had annotated transcription start sites and chimpanzee sequence was available (July 2003)....

Báo cáo y học: "Endovascular treatment of iatrogenic axillary artery pseudoaneurysm under echographic control: A case report" potx

... surgical approach in the axillaryarea may be associated with many complications, suchas major blood loss and potential damage of adjacentneurovascular structures. The surgical inaccessibility of axillary ... contrast materials.Case Report: A 77 years old man presenting with acute renal failure and haemoglobin decrease arrived with anexpanding pseudoaneurysm of the left axillary artery from a pacemaker ... lesion and proximal and distal diameter of the axillary artery of 7 and 7.2 mm respectively (Figure 2).Under loco-regional anesthesia the brachial artery wascannulated in a retrograde fashion with...

Báo cáo y học: "Three variations of the laryngeal nerve in the same patient: a case report" potx

... safety of thyroid operat ions mainly depends on thesurgical anatomy of the ILN. The nerve has many varia-tions on its cervical course and full knowledge of RLNanatomy, including all variations, ... laryngeal nerve. InSurgery of the Thyroid and Parathyroid Glands. Edited by: Randolph GW.Philadelphia: Saunders; 2003:300-342.5. Docimo G, Avenia N, Ragusa M, Gili S, Parmeggiani D, Casalino ... Lucchini R, Sanguinetti A, D’Ajello M,Vannucci J, Galasso V, Bartolo M, Ragusa M, Avenia N: Non-recurrentinferior laryngeal nerves and sympathetic-inferior laryngeal anastomoticbranches: 6 years’...

Báo cáo y học: " Anaplastic carcinoma of the pancreas producing granulocyte-colony stimulating factor: a case report" potx

... 4 of 4(page number not for citation purposes)7. Ohtsubo K, Mouri H, Sakai J, Akasofu M, Yamaguchi Y, Watanabe H,Gabata T, Motoo Y, Okai T, Sawabu N: Pancreatic cancer associ-ated with granulocyte-colony ... Hirao M, KurokawaK, Honma A, Asakawa M, Suzuki A: Granulocyte colony-stimulat-ing factor producing lung large cell carcinoma with sarcoma-tous transformation. Nihon Kyobu Shikkan Gakkai Zasshi ... Asaka M: A case of granulo-cyte-colony stimulating factor producing ductaladenocarcinoma of the pancreas. Nippon Shokakibyo GakkaiZasshi 2007, 104(2):233-238.5. Gotohda N, Nakagohri T, Saito...

Báo cáo y học: "Combination effect of antithrombin and recombinant human soluble thrombomodulin in a lipopolysaccharide induced rat sepsis model" pptx

... 2:1745-1751.7. Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M,Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The N-terminaldomain of thrombomodulin ... disseminated intravascularcoagulation. Thromb Haemost 2005, 94:975-979.10. Saito H, Maruyama I, Shimazaki S, Yamamoto Y, Aikawa N, OhnoR, Hirayama A, Matsuda T, Asakura H, Nakashima M, Aoki N: ... Sama A, Tracey KJ: HMG-1 as a late mediator of endotoxinlethality in mice. Science 1999, 285:248-251.24. Ito T, Kawahara K, Nakamura T, Yamada S, Nakamura T, AbeyamaK, Hashiguchi T, Maruyama...

Báo cáo y học: "Open Access Collaborative care for patients with bipolar disorder: a randomised controlled trial" doc

... measures are psychosocial function-ing, symptoms, and quality of life. Secondary outcomemeasures are mastery, attitude towards medication and satisfaction with care. Family members or friends of patients ... guidelines; and enhancing access to care and continuity of care. Thecare manager, a nurse or a social worker, provided activelyoutreaching care when a patient was at risk of losing con-tact with mental ... Perry A, Tarrier N, Morriss R, McCarthy E, Limb K: Randomised controlledtrial of efficacy of teaching patients with bipolar disorder to identifyearly symptoms of relapse and obtain treatment....

Xem thêm