báo cáo khoa học: " A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" pdf

Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

... Association for Computational Linguistics, pages 912–920,Jeju, Republic of Korea, 8-14 July 2012.c2012 Association for Computational LinguisticsA Ranking-based Approach to Word Reordering for Statistical ... the paper.2 Word Reordering as Syntax Tree NodeRankingGiven a source side parse tree Te, the task of word reordering is to transform Te to Te, so that ecanmatch the word order in ... the word order in target language. To this end, wepropose a simple but effective ranking-based ap-proach to word reordering. The ranking model isautomatically derived from the word aligned...

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... Czech Republic, June 2007.c2007 Association for Computational LinguisticsA Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗Sharon GoldwaterDepartment of LinguisticsStanford ... parameters.We show using part-of-speech tagging thata fully Bayesian approach can greatly im-prove performance. Rather than estimatinga single set of parameters, the Bayesian ap-proach integrates ... intuitively sensible prediction resultsfrom the fact that the Bayesian approach is sensitive to the robustness of a choice of t to the value of θ,as illustrated in Figure 1. Even though a sequencewith...

Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

... 73–76,Prague, June 2007.c2007 Association for Computational LinguisticsA Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments Yi-Chia Wang, Mahesh ... that context is to enable the quality and nature of discussions that occur within an on-line discussion board to be communicated in a summary to a potential new-comer or group moderators. ... have proven suc-cessful for email act classification in comparison with a feature based approach. Our evaluation demonstrates for the three separate dimensions of a context oriented annotation...

Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx

... learned sub-word models to guideits hypotheses on phone boundaries. Bayesian Model for Segmentation Our model isinspired by previous applications of nonparametric Bayesian models to segmentation ... supervision, our model captures andlearns the acoustic characteristics of a language au-tomatically and is able to produce an acoustic model that outperforms a language-mismatched acoustic model trained ... nonparametric Bayesian model. More speciﬁcally, we formulate a Dirichlet pro-cess mixture model where each mixture is a Hid-den Markov Model (HMM) used to model a sub-word unit and to generate...

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... Republic of Korea, 8-14 July 2012.c2012 Association for Computational LinguisticsA Two-step Approach to Sentence Compression of Spoken UtterancesDong Wang, Xian Qian, Yang LiuThe University of ... effect of different compression meth-ods on a meeting summarization task, but did notevaluate sentence compression itself.We propose to use a two-step approach in this pa-per for sentence compression ... anno-tators were asked to select words to be removed to compress the sentences. In the second step, 6 an-notators (different from the ﬁrst step) were asked to pick the best one from the 8 compressions...

Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx

... Syntax-Free Approach to Japanese Sentence CompressionTsutomu HIRAO, Jun SUZUKI and Hideki ISOZAKINTT Communication Science Laboratories, NTT Corp.2-4 Hikaridai, Seika-cho, Soraku-gun, Kyoto ... presented the compressed sentences to sixhuman subjects and asked them to evaluate the sentence for ﬂuency and importance on a scale 1(worst) to 5 (best). For each source sentence, theorder in ... suitable for Japanese sentence com-pression because in many cases it cannot repro-duce human-produced compressions.As an alternative to these tree trimmingapproaches, sequence-oriented approaches...

Báo cáo khoa học: "A Noisy-Channel Approach to Question Answering" docx

... written question- factoid template pairs, which are applied on the different sources to yield simple natural language question- factoid pairs. Consider, for example, the following two factoid -question ... in Section 3.1 to generate training cases for all QA pairs in the three corpora. To help our model learn that it is desirable to copy answer words into the question, we add to each corpus ... “legal” is related to “rule”, which in turn is related to “mandatory”; that “age” is related to “aged”; and that “Argentine” is related to “Argentina”. It is not difficult to see by now that...

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... A multi-staged approach to identifying complex events in textual dataConrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer,Sean Munson, Marc Vilain, and Benjamin ... understood as relations(job title) or events (acquisitions).3.3 Statistical trainingBecause we had no existing methods to addressfinancial events or relations, we took this oppor-tunity to ... importantcontextual information using text classificationmethods. We also use text classification methods to help users to more quickly focus on an areawhere interesting transactions exist in an interac-tive...

Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

... in dealingwith serial verb construction in CCG in Đ 3. I de-scribe the hybrid model of CCG and the ller-gapmemory in Đ4. I then discuss the margin of gener-ative power introduced by the memory ... SVCs: the series of V1 to V3and the series of V4 to V5, be-cause they do not share their tenses. The direc-tional verb ‘go’ performs as an adverb identi-fying the outward direction of the ... registers for being ﬁlled to gaps found in the rest of the input sentence. These regis-ters are too powerful since they enable ATN to recognize the full class of context-sensitive gram-mars. In Type...

Báo cáo khoa học: "A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE TEXTS" pptx

... importance evaluation. It is constituted by production rules, called importance rules, having the usual IF-THEN form. Rules can be 245 A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE ... relative importance values to the different parts of a text and can resolve or explain conflicting evaluations seems more appropriate. Such an approach allows taking into account in a flexible ... at the very beginning (Hahn and Reimer, 1984). In this paper we focus on the notion of importance from a computational standpoint, and we propose a rule-based approach to importance evaluation....

Báo cáo khoa học: "A Phonetic-Based Approach to Chinese Chat Text Normalization" ppt

... Many words in chat text are anomalous to natural language. Chat text comprises of ill-edited terms and anomalous writing styles. We refer chat terms to the anomalous words in chat text. The dynamic ... Dynamic Chinese Chat Text. EACL’06 NEW TEXT workshop, pp.48-55. Xia, Y., K F. Wong and W. Li. 2006b. Constructing A Chinese Chat Text Corpus with A Two-Stage Incremental Annotation Approach. ... error-driven approach is pro-posed to detect chat terms in dynamic Chinese chat terms by combining standard Chinese cor-pora and NIL corpus (Xia et al., 2006b). Lan-guage texts in standard Chinese...

Báo cáo khoa học: "A Term Recognition Approach to Acronym Recognition" pot

... acronyms.Assuming terms appearing frequently inthe proximity of an acronym to bethe expanded forms (deﬁnitions) of theacronyms, we apply a term recognition method to enumerate such candidates and to measure ... disambiguated.Thus, discovering acronyms and relating them to their expanded forms is important for terminol-ogy management. In this paper, we present a term recognition approach to construct an acronym dic-643 ... Approach to Acronym Recognition Naoaki Okazaki∗Graduate School of InformationScience and TechnologyThe University of Tokyo7-3-1 Hongo, Bunkyo-ku, Tokyo113-8656 Japanokazaki@mi.ci.i.u-tokyo.ac.jpSophia...

Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx

... receiving the TIDES marketing materials,whether they felt the materials were compelling, andwhether they are referring patients to TIDES depression care managers.Discussion Collaborative depression ... about the challenges andbenefits of implementing TIDES. Frontline providers The TIDES collaborative care model can only succeed iffrontline providers in the clinics, especially primary care physicians ... mail). Finally, they are most likely to find mar-keting messages convincing when fellow providers,including clinicians like themselves or TIDES care manag-ers, deliver the message.VeteransTIDES...

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCAB genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCAD genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGAB genome CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT ... large in/ del event relative to the B and D genomes that is represented by bold red letters. A genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCAB...

Xem thêm