báo cáo khoa học: " Curricula for teaching the content of clinical practice guidelines to family medicine and internal medicine residents in the US: a survey study" pot

... EAA, RM,MCW, AM, and HJS; acquisition of data: EAA, RM, AS,MCW, AM, and TR; analysis and interpretation of data:EAA, GHG, and HJS; drafting of manuscript: EAA; criticalrevision of the manuscript ... for teaching the content of CPGs in family medicine and internal medicine residency programs in the United States.Methods: We surveyed the directors of family medicine and internal medicine residency ... medical education. Taking into account compet-ing demands and requirements, program directors need to consider the value of teaching of the content of CPGs on the clinical care and educational...

Báo cáo y học: "Curricula for teaching the content of clinical practice guidelines to family medicine and internal medicine residents in the US: a survey study" ppt

... Schunemann HJ,Akl EA, Mustafa R, Slomka T, Alawneh A, et al.: An educationalgame for teaching clinical practice guidelines to Internal Medicine residents: development, feasibility and acceptabil-ity. ... conducted a national survey of directors of family medicine and internal medicine residency programs in the US. We identified the program directors and obtainedtheir contact information using the American ... educational values, the imple-mentation of CPGs remains suboptimal among family medicine and internal medicine trainees in the US for a number of clinical areas such as: management of hyper-tension...

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... AlaP2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K ... ggcgtcatcggtggagggctttttggcaccaaaaag Val16, Val17 and Leu18 to GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K24A...

báo cáo khoa học: "Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral meniscus: a case report" ppt

... (Figure 2A) . The articular sur-face of the lateral femoral condyle had normal articularcontinuity and contour, but soft ening of cartilage at the margins of the OCD within the lateral femoral condylewithout ... intermittent paininvolving her right knee. A physical examination at thistime revealed mild tenderness to the lateral joint line,butallothertestresultsandfindingsfromplainradio-graphs were normal. An ... bymeniscoplasty. They proposed an abnormal contactforce may lead to OCD lesion in the lateral femoral con-dyle. From t hese observations, our hypothesis is thatcorrection of abnormal loading to the lateral...

Báo cáo khoa học: "Radiosurgery for pituitary adenomas: evaluation of its efficacy and safety" ppsx

... et al. reported a mean time to hormonal normalization of 21 months (2.8-59.1 months) and actuarial incidence of hormonal normalization at 1 and 3 years of 16.1% and 37.6%. In our study, the meantime ... radiationtherapy for acromegaly and persistent median time to normalizationofGHandIGF-1was1. 4and7 .1yearsrespectively [8].However, as well observed by Brada et al., the latencyperiod to achieve ... of target volume and the respect to the dose tolerance of adjacent tissues are key factors to achieving these results.ConclusionsRS is an effective and safe therapeutic option in the management...

Báo cáo y học: " Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft"

... Clinical pharmacokinetics of vancomycin. Clin Pharmacokinet 1986;11(4):257-82. 46. Garazzino S, Aprato A, Baietto L, D'Avolio A, Maiello A, De Rosa FG, Aloj D, Siccardi M, Biasibetti A, ... tradi-tional approaches may be found in the quality of the surgical debridement and dead space management 71. Dead space management is performed by a new prosthesis the same as with a spacer ... new ways of antibiotic delivery are required. The cri-teria of antibiotics for efficacy against biofilms are different from those meant for action against plank-tonic bacteria. In any case the...

báo cáo khoa học: "Computing genetic evaluations through application of generalized least squares to an animal model" pot

... & QUAAS described an animal model for simultaneous evaluation of males and females based on available performance data from both evaluated and relatedanimals. The ... coefficients of inbreeding for the sire and dam of the k’&dquo; animal, and Qa is the additive genetic variance in the base population. For i = 0, ao is the vector of breeding ... the linear model containscovariates, and even then careful avoidance of collinearity and scaling of variables canlessen problems due to loss of accuracy. If X is an...

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... central TIM barrel domain,including domain B and the C-terminal domain C for rBAT proteins (669 residues on average); (b) the cata-lytic TIM barrel domain, including domain B and the C-terminal ... lizards and frogs (lacking both essential aspar-tates at the b4- and b7-strands) and also from someﬁshes (lacking the b4-strand aspartate). This may meanthat the eventuality of a- glucosidase ... covering mainly the b-strands of the catalytic TIM barrel [3,11–13]. Of the three GHfamilies of the clan GH-H, it was the family GH13that was originally established as the a- amylase family [14–17]....

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... Cd) initially to the a domain, thereby lead-ing to formation of the M4 a cluster prior to formation of the M3b cluster, demonstrating that the individualbinding constants of divalent metal ... for the a domain are larger than those for the b domain.Further interpretation of these data resulted in the proposal of positively cooperative metal binding as the primary metallation mechanism ... the a domain, has been construedas being an indicator of cooperative metal binding to the a domain. This study focuses on the metallation of the isolated a domain, with the purpose of clarifyingthis...

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... 40–66 of the cofactor is important in the folding of the protein and that the C-terminal part of the cofactor,which is absent in the truncated form, directly interactswith the substrate-binding ... the last year, DHF has again been on the increase in India and in several Asian countries because of sea-sonal factors. Dengue is one of the most importantmosquito-borne viral diseases affecting ... geographic areas, and DHF has spread fromSouth East Asia to the Western Paciﬁc and the Americas. A substantial number of people travelling to endemic regions are also infected each year. In the last...

Xem thêm