0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Development of a theory of implementation and integration: Normalization Process Theory pdf

báo cáo khoa học:

báo cáo khoa học: " Development of a theory of implementation and integration: Normalization Process Theory pdf

... purposes) Implementation ScienceOpen AccessResearch article Development of a theory of implementation and integration: Normalization Process Theory Carl R May*1, Frances Mair2, Tracy Finch1, Anne ... that enable the identification,differentiation, and codification of the qualities and prop-erties of cases and classes of phenomena.2. Systematic explanation: A theory must provide anexplanation ... derived a set of empirical generalizationsfrom analysis of data collected in qualitative studies of healthcare work and organization. We developedan applied theoretical model through analysis of...
  • 9
  • 374
  • 0
Báo cáo y học:

Báo cáo y học: "Development of a theory of implementation and integration: Normalization Process Theory" ppsx

... of cases and classes of phenomena.2. Systematic explanation: A theory must provide anexplanation of the form and significance of the causal and relational mechanisms at work in cases or classes ... twomain pieces of work, quantitative data analysis and research synthesis.Qualitative data analysisWe integrated the NPM in qualitative data analysis inthree large studies (of the implementation ... CentralPage 1 of 9(page number not for citation purposes) Implementation ScienceOpen AccessResearch article Development of a theory of implementation and integration: Normalization Process Theory Carl...
  • 9
  • 441
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV site of ... primers 5¢-CCTGCAGCAGCGGCAGGCAAGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGGCCGGGGCACACCAG-3¢, and primers 5¢-GGCATGCTGGCTCGCCTGGCTGTGGAAGCA-3¢ and 5¢-GGATCCTGGGAAAGCGCCGCCGGATTTGGC-3¢, respec-tively. ... Tomohiro Chiba for preparation of embryonicday 9.5 mouse embryos; Dr Dovie Wylie and Ms Tak-ako Hiraki for expert assistance; and all members of theDepartments of Pharmacology and Anatomy at KeioUniversity...
  • 14
  • 499
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

... Hajiˇc, Massimiliano Ciaramita, Richard Johans-son, Daisuke Kawahara, Maria Ant`onia Mart´ı, Llu´ısM`arquez, Adam Meyers, Joakim Nivre, SebastianPad´o, JanˇStˇep´anek, Pavel ... annotatedinstances. In contrast, our study focused on a se-lect group of nominal predicates, each associatedwith a large number of annotated instances.3 Data annotation and analysis3.1 Data annotationImplicit ... Deepak Ravichandran. 2004.Automatically labeling semantic classes. InDaniel Marcu Susan Dumais and Salim Roukos, ed-itors, HLT-NAACL 2004: Main Proceedings, pages321–328, Boston, Massachusetts,...
  • 10
  • 402
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... is a web center of online lin-guistic services aimed at both demonstrat-ing a range of language technology tools and at fostering the education, research and development in natural language ... Portuguese language and are madeavailable to foster the education, research and de-velopment in natural language science and tech-nology.This paper adheres to the common format de-fined for ... 16,000 lemmas from both European and American variants of Portuguese. They arealigned with the translationally equivalent con-cepts of the English Princeton WordNet and, tran-sitively, of the...
  • 4
  • 299
  • 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGGTable 3. Plasmids used in this study.Plasmid Description SourceYCplac111 CEN4 ARS1 ... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPaseSKD1 ⁄ VPS4 impairs membrane trafficking out of endo-somal...
  • 14
  • 362
  • 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... (pNPaGlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno-pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra-nose (pNPaRha) (less than 10 lm pNP liberated ... trehalose, turanose, raffi-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St. Louis, MO,USA). Galactomannans ... and superimposition of an equilibrium mixture of a- and b-galactose from Oryza sativa a- galactosidase [28],N-acetyl -a- galactosamine from Gallus gallus a- N-acet-ylgalactosaminidase [29] and melibiose from human a- galactosidase...
  • 14
  • 579
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

... can motivate a speaker to use a variantin place of a canonical form (Glucksberg, 1993).Nevertheless, lexical and syntactic flexibility maywell be used as partial indicators of semantic ana-lyzability, ... simply take the mostdominant pattern as the canonical one. Instead, wecalculate a -score for the target pair and each pattern :in which is the mean and the standard deviationover the sample ... ictionary (CC ID)(Seaton and Macaulay, 2002). Otherwise, the pairis considered literal. We then randomly pull out development and test pairs (half idiomatic and half literal), ensuring both low and...
  • 8
  • 295
  • 0
báo cáo khoa học:

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

... and GMM analyzed and interpreted the data from our patient regarding clinical presentation, and hematological and imaging data. GK and TS performed the first labial dissection and the operative ... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass and abdominal pain...
  • 14
  • 367
  • 0
báo cáo khoa học:

báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps

... AccessDysphagia as a manifestation of esophagealtuberculosis: a report of two casesJoana Gomes*, Ana Antunes, Aurora Carvalho and Raquel DuarteAbstractIntroduction: Esophageal involvement ... presentation: We present two cases of esophageal tuberculosis in 85- and 65-year-old male Caucasianpatients with initial complaints of dysphagia and epigastric pain. Upper gastrointestinal endoscopy ... ethambutol [12,13]. Surgical treatment is reservedfor complications such as esophageal, tracheoesopha-geal and aortoesophageal fistulas, the latter of whichcan lead to death by massive hematemesis...
  • 5
  • 355
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM