báo cáo khoa học: " Classification of unknown primary tumors with a data-driven method based on a large microarray reference database" ppsx
báo cáo khoa học: " Classification of unknown primary tumors with a data-driven method based on a large microarray reference database" ppsx
... unknown primary tumors with a data-driven method based on a large microarray reference databaseKalle A Ojala, Sami K Kilpinen and Olli P Kallioniemi*AbstractWe present a new method to analyze ... scienti-fic data.Additional materialAdditional file 1: An illustration of the method used to calculatesimilarities between a test sample and the reference data. (a) Theweight of a gene for each cancer ... ts-scores for that cancer.Additional file 2: A summary of the reference data, the name of each cancer type and the number of samples it has.Additional file 3: Heatmap of all genes and all cancers used...
- 12
- 391
- 0
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
... Detection of nucleolar organizer and mitochondrial DNAinsertion regions based on the isochore map of Arabidopsis thalianaLing-Ling Chen1and Feng Gao21 Laboratory for Computational Biology, Shandong ... it a model plant forresearch [16]. The compositional organization of the A. thaliana genome has been studied by several groups[5,7]. Carels and Bernardi analyzed the contigs of A. thaliana and ... available onlineTable S1. The codon usage, codon preference andamino acid usage of the genes in the five Arabidopsisthaliana chromosomes.Table S2. The codon usage, codon preference andamino acid...
- 9
- 523
- 0
báo cáo khoa học: " Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data" docx
... ,+ At5G52310 RD2 9A Promoter Drt1 Drt2 Drt3 TTAGGATGGAATAAATATCATACCGACATCAGTTTGAAAGAAAAGGGAAAAAAAGAAAAAATAAATAAAAGATATACTACCGACATGAGTTCCAAAAAGCAAAAAAAAAGATCAAGCCGACACAG ATACCGACATC: ... ACCGACATGA Drought: GCCGACAC ATACCGACATC: DREB1Aox DREB1Aox: ACCGACATGAG ABA: AGCCGACACA TACCGACAT: DRE DRE: TACCGACAT DRE-core: GCCGAC Drt4 Drt5ACACGCGTAGAGAGCAAAATGACTTTGACGTCACACCACGAAAACAGACGCTTCATACGTGTCCCTTTATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTCTGTTTTACTCACAAATACACGCGTAG: ... Drt5ACACGCGTAGAGAGCAAAATGACTTTGACGTCACACCACGAAAACAGACGCTTCATACGTGTCCCTTTATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTCTGTTTTACTCACAAATACACGCGTAG: Drought TACGTGTCCC: Drought ATACGTGTCCC: ABAACACGCGT: AtREG536 TACGTGTC: AtREG557...
- 14
- 241
- 0
Tài liệu Báo cáo khoa học: "Knowledge Acquisition from Texts : Using an Automatic Clustering Method Based on Noun-Modifier Relationship" pptx
... (collocations) within a fixed-size window. Given that candidate terms extraction in LEXTER is based on a morpho- syntactical analysis, our definition allows us to group collocation information ... lan- guage and specialised data analysis functions from Splus TM software. Given the individuals-variables matrix above, a similarity measure between the individuals is calcu- lated 3 and ... Masson, Paris. Resnik P. 1993. Selection and Information : A Class -Based Approach to Lexical Relationships. PhD Thesis, University of Pennsylvania. Zernik U. 1993. Corpus -Based Thematic Analysis....
- 3
- 408
- 0
Báo cáo khoa học: "Analysis of Unknown Words through Morphological Decomposition" potx
... which conjunctions of morphemes are valid. Thus valid analyses re- quire a valid segmentation and a valid morpho- syntax. In the larger descriptions developed in the system a "categorial ... basic mor- phology system has been modified to analyse words containing morphemes that are not in the lexicon. The analysis method offers segmenta- tion and morphological analysis (based on ... the known material would be derived from the lexicon). The advantages of this method are that the pronunciation and word stress assignment are more likely to be accurate, and also that, if there...
- 6
- 413
- 0
Báo cáo khoa học: "CLASSIFICATION OF MODALITY FUNCTION AND ITS APPLICATION ANALYSIS TO JAPANESE LANGUAGE" doc
... proposition and rnodality, TM analysis of modality is as indispensable as that of proposition for natural language understanding and machine translation. However studies on natural language analysis ... types of the semantic relations, namely, case relation, noun concept relation, embeding relation and conjunctive relation. All of these semantic relations are analyzed in a uniform framework. ... hashiru kotogadeki na_Ai ga, watashi ga kinou eiga de mita densha wa sofa wo tobu kotomodeki ta. Though a train can run only on a railroad, the train [ saw in a movie yesterday could also fly....
- 8
- 448
- 0
Báo cáo khoa học: "Classification of forest humus forms: a French proposal" docx
... h1 1" alt ="" ...
- 12
- 130
- 0
báo cáo khoa học:" Assessment of Chronic Illness Care with the German version of the ACIC in different primary care settings in Switzerland" potx
... reconciliation was carried outinto a single forward translation and first version.Back translationThe back translator who was a native speaker of the ori-ginal language English and unaware of ... of these organizations. For examplethe mediX organization has been one of the first mana-ged care organizations in Switzerland focusing on gatekeeping and on a team based patient centred approach ... two medical assistants.Their relationship is often more hierarchical than team based. Lack of resources and the still predominant tradi-tion of paternalism instead o f partnership and multipro-fessional...
- 5
- 256
- 0
Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx
... forms a stacking interaction with a guanine, and adopts a closed conformation of theactive site. Asn41 has an identical conformation in allstructures that we compared. The main role of this ... main chain nitrogen of Arg42 andO6 of the leading guanine. Accuracy of the docking wasassessed on the basis of scoring values calculated by glide.Analysis of the positions and conformations ... Ribbon diagram of RNase Sa2.Table 2. Superposition of corresponding CA atoms of RNase Sa(2SAR, molecule A) , barnase (1BRN, molecule L), binase (1GOY,molecule A) and RNase T1 (1RLS) on RNase Sa2...
- 13
- 523
- 0
Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt
... Kajimura N, Yamazaki M, Morikawa K, Yamazaki A & Mayanagi K (2002) Three-dimensional structure of non-activated cGMP phosphodiesterase 6 and compari-son of its image with those of activated ... H, Matsuura I, Hayashi F,Yamazaki RK & Usukura J (2010) Mechanism for theregulation of mammalian cGMP phosphodiesterase 6.2: isolation and characterization of the transducin-activated ... indicate that the apparentStokes’ radius of cGMP-treated Pabc was 4–7 A ˚largerthan that of cGMP-nontreated Pabc, i.e. the Stokes’radius of Pabc appears to be increased when Pabchaving one...
- 19
- 406
- 1
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ