0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " The membrane-spanning 4-domains, subfamily A (MS4A) gene cluster contains a common variant associated with Alzheimer’s disease" potx

báo cáo khoa học:

báo cáo khoa học: " The membrane-spanning 4-domains, subfamily A (MS4A) gene cluster contains a common variant associated with Alzheimer’s disease" potx

... 8RESEARC H Open Access The membrane-spanning 4-domains, subfamily A (MS 4A) gene cluster contains a common variant associated with Alzheimer’s diseaseCarmen Antúnez1,2†, Mercè Boada3,4†, Antonio ... P, Hardy J,Huentelman MJ, Myers AJ, Barmada MM, Demirci FY, Baldwin CT, et al: Common variants at MS 4A4 /MS 4A6 E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer’s disease. Nat Genet ... DC,Gill M, Lawlor B, Lynch A, Brown KS, Passmore PA, Craig D, et al: Common variants at ABCA7, MS 4A6 A/MS 4A4 E, EPHA1, CD33 and CD2AP are associated with Alzheimer’s disease. Nat Genet 2011, 43:429-435.26....
  • 8
  • 391
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... analysis of the study. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll ... lower as compared with the other admit-tance category groups. Similarly, the number of daily routineCXRs with a new and unexpected abnormality resulting in a change to therapy was similar among ... and are not related to the presence of abnormalitieson the CXR. Unfortunately, these abnormalities formed a sub-stantial part of all new and unexpected abnormalities in ouranalysis (1.0% and...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis project was supported by grants from the Aus-trian Science ... ACTIN2 gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGTGCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAGAATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATCAGATTTTACGC-3 ... PTI1-4(At2g47060) was cloned in the pBD-GAL4 cam (Stratagene,La Jolla, CA, USA) and were each used as bait to screen anArabidopsis pACT2 cDNA library [36]. The yeast strainPJ69- 4A [37] containing...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH)SJS209 CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH)SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2)SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCRproduct was purified, treated with T4 exonuclease tocreate vector-compatible ... FEBScontaining 100 lm of (GlcNAc)1–4was analysed at the start, in the middle and at the end of each series of sam-ples. The resulting average values of the standards (display-ing standard deviations ... (5¢-CTCGAGTTATAGCTTTTTCCATGGACCAAAATCTC-3¢) contained a XhoI restriction site starting imme-diately downstream of the stop codon of the chitinase gene. The amplified chitinase fragment was ligated...
  • 14
  • 683
  • 0
Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

... design andadvancement of antiviral therapeutics.AbbreviationsaaRSs, aminoacyl-tRNA synthetases; CA, capsid protein; CA-CTD, C-terminal domain of CA; CA-NTD, N-terminal domain of CA; CyPA,cyclophilin ... HIV, whereas aminoacylation is not. In addition,LysRS packaging is independent of tRNA packaging.Although aaRSs cognate to the primer tRNA arestrong candidates for packaging signals, the selectivepackaging ... infectivity. The necessity of CyPA for viralinfectivity makes it a potential therapeutic target.CyPA is shaped like a b-barrel formed by eight anti-parallel beta strands with two alpha helices that capthe...
  • 10
  • 398
  • 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

... (Fig. 1B). The transfected NCI-H460 cells werethen lysed and assayed for the activity of senescence- associated b-galactosidase (SA-b-gal; pH 6.0), a bio-marker that is tightly associated with senescence ... Texas SouthwesternMedical Center, Dallas, TX, USA).RNA extraction and real-time quantitative PCRTotal cellular RNA was extracted from the 293T cellsaccording to the Promega Total RNA Isolation ... [27].Briefly, the chromatin solution was precleared with 50 lLofprotein A agarose beads (Upstate Biotechnology, SantaCruz, CA, USA). The soluble fraction was collected, and5 lg of antibodies against acetyl-histone...
  • 10
  • 374
  • 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... case. The heat-induced activationof kinases such as Akt has been shown to increaseHSF1 activity. Enhanced Ras maturation by heat stresswas associated with a heightened activation of extra-cellular ... in Saccharomycescerevisiae, or the addition of exogenous fatty acids,can change the unsaturated ⁄ saturated fatty acid ratioand exert a significant effect on the expression of heatshock genes ... Luciferase activitywas measured as described in [48].Statistical analysisAll data are expressed as mean ± SD. Student’s pairedt-test (a ¼ 0.05) with the Bonferroni adjustment was usedto compare...
  • 10
  • 452
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx

... for applications means building the right FL (or at least a reason- able approximation of it) in a short time. The right FL contains those words that are necessary for the application and ... tied together by "similarity" covering the most part of the lexical area of a specific domain. Marking synsets with field labels has a clear ad- vantage: in general, given a polysemous ... quantitative and qualitative informa- tion for each entry in the FL can be very high and it is not transportable across domains and 225 Proceedings of EACL '99 applications, as it contains...
  • 4
  • 436
  • 0
Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

... 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢Vps4 Ter2 F 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢Vps4 Ter2 R 5¢-AGCACGTTAATCAATTGACTAATCTGGTTCTTTTAA-3¢Vps4 RDE F 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢Vps4 ... 5¢-GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG-3¢Vps4 Dstr R 5¢-GGGCGGATCCTCTGCTTTTCTTTATC-3¢Vps4 Ter1 F 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢Vps4 Ter1 R 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢Vps4 ... 5¢-GACGACGAAACAAGAAAAGATGGCGCCATCGAGATG-3¢Vps4 LTP R 5¢-CATCTCGATGGCGCCATCTTTTCTTGTTTCGTCGTC-3¢Vps4 GAI F 5¢-TGCTCTCCAGGTGATGATATTGAAGCTGATGAATTA-3¢Vps4 GAI R 5¢-TAATTCATCAGCTTCAATATCATCACCTGGAGAGCA-3¢P....
  • 17
  • 313
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM