báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx

... loss of alternative, collateral DNA repair pathways, such as the base-excision repair pathway. Proteins encoded by the breast cancer genes BRCA1 and BRCA2 have important roles in the repair of ... that are synthetically lethal. Lower case, mutant; upper case, wild-type. (b) The effect of mutations and inhibitors on a pair of synthetically lethal genes, A and B. A B Viable A b Viable a ... in the scenario outlined above. For example, mutations of two genes (such as Review Synthetic lethality: a framework for the development of wiser cancer therapeuticsWilliam G Kaelin JrAddress:...

Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot

... dirty-window-effect. For the perceptual evaluation of each artifact, a particular instantiation of the generalized framework, was presented and the associated results wereEURASIP Journal on Image and Video ... Evaluation. The development of frame-work for halftone flicker evaluation will parallel the approach, utilized above, for the evaluation of DWE, sinceflicker and DWE are related artifacts. The ... Q,andR each have a value of 1. L,andShave each a value of 0. P has a value of −1. The “ArtifactMap” is Fi. Fi(m, n) has the form described in [1]. We doevaluate Widifferently in this paper....

Báo cáo khoa học: "Preventing suicide: a resource for the family" docx

... having eaten anything. They take laxatives, antac-ids and other medications to get relief for their gastroin-testinal disturbances, they complain of losing their tastesensation, they lack appetite, ... of Granma, CubaEmail: Sergio A Pérez Barrero - serper.grm@infomed.sld.cuAbstract The family can play an important role in the prevention of suicide if it is capable of aiding the mentalhealth ... during their lives and neverexperienced an act of self-aggression. However, when sui-cidal ideas appear as a symptom of mental disorder andthey are accompanied by a high suicidal tendency, anincreasing...

báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

... hemobilia with selective hepatic artery embolization.J Vasc Intervent Radiol 1995, 6(5):793-798.10. Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K:Transcatheter arterial embolization ... Selective arter-iography may also sho w active bleeding and anatomicvariations such as an anomalous or replaced hepaticartery [6], and can be used in simultaneous diagnosis andtreatment. The recent ... [2]. Most HAPs occurextrahepatically, predominantly in the right hepatic artery[2]. Intrahepatic HAPs account for only about 20% of allHAPs and are often a complication of percutaneous pro-cedures...

báo cáo khoa học: " Worry as a window into the lives of people who use injection drugs: a factor analysis approach" pot

... (interpreted as the amount of variance accounted for by each factor) was constructed. The point at which the slope of the plot changes from a rapid to a slow decline is the cut-off for the number of factors ... completed the statistical anal-ysis, and wrote the manuscript draft. All authors read andapproved the final manuscript.AcknowledgementsWe wish to particularly thank the participants of this ... Columbia, V8W 2J5, Canada, 2Department of Mathematics and Statistics, PO BOX 3060 STN CSC, Victoria, British Columbia, V8W 3R4, Canada and 3Department of Anthropology, University of Victoria,...

báo cáo khoa học: " High resolution melting analysis for the detection of EMS induced mutations in wheat SbeIIa genes" doc

... ctctgcccactaagggt aaatttcatttaataatgtaatggagatcg 204IX ccttttgtgaccatttactaaggata accagaaacaggtgaaataact 157X acaatacttagaggatgcatctga ggtgaagaggcgcataca 212XI ggtatttctgacttgtatgaccatt accagataaacagtaaagcagc ... gggtatacctcggtggattc agactagtggaggcgttt 167V gaaggtatcgtctaattgcatatct caataaattggaaggtgtctcgtt 154SBEIIa-D IX accatttactaaggatatttacatgcaa accagaaacaggtgaaataact 151X acaatacttagaggatgcatctga ... aactctgcctactaagggt acactggaaattccatttaataatgtaac 204IX ccttttgtgaccatttactaaggata ccggaaacaggtgaaataact 157II actattgtagtcatccttgcatt atgaagatttaccggcacg 157III tcagtctgctctacaattgctat gaaagcagcgggtaggc...

Báo cáo khoa học: "Recombinant activated factor VIIa for the treatment of bleeding in major abdominal surgery including vascular and urological" doc

... is formed only in the region of endothelial damage, so that a local hemostasis occurs via the subsequent activation of fac-tors IX and X and the formation of thrombin. After that,thrombin activates ... 1Flowchart on the analyses of case seriesFlowchart on the analyses of case series. rFVIIa, recombinant activated factor VII.Available online http://ccforum.com/content/12/1/R14Page 11 of 11(page ... DM 3rd, Hoffman M: The effect of temperature and pH on the activity of factor VIIa:implications for the efficacy of high-dose factor VIIa in hypo-thermic and acidotic patients. J Trauma 2003,...

Tài liệu Báo cáo khoa học: Local stability identiﬁcation and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... reportedthat multiple mutations can cause large changes in the average conformation of denatured proteins. Here weshow that a speciﬁc single mutation or removal of a speciﬁc fragment can cause large ... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of ... structure-based analysis of staphylococcal nuclease. Proteins: Structure, Functionand Genetics 27, 171–183.15 Flanagan JM, Kataoka M, Fujisawa T & EngelmanDM (1993) Mutations can cause large changes...

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... Koshiyama A, Hamada FN, Namekawa SH, IwabataK, Sugawara H, Sakamoto A, Ishizaki T & SakaguchiK (2006) Sumoylation of a meiosis-speciﬁc RecA homo-log, Lim15/Dmc1, via interaction with the small ... Iwabata K, Koshiyama A, Yamaguchi T, Sugawara H,Hamada FN, Namekawa SH, Ishii S, Ishizaki T, ChikuH, Nara T et al. (2005) DNA topoisomerase II interactswith Lim15/Dmc1 in meiosis. Nucleic Acids ... Still-man B & Araki T (2001) FASCIATA genes for chro-matin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems. Cell 104, 131–142.24 Gaillard PH, Martini...

Báo cáo khoa học: Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function pptx

... 5¢-GGGACTATGATGATGGGTTTGTGAGGAAATGT-3¢ and 5¢-ACATTTCCTCACAAACCCATCATAGTCCC-3¢. HEL cell nuclearproteins carried by the probes were separated using strept-avidin-magnetic beads (Qiagen, Valencia, ... 5¢-AATGTTCATGGGGCGGCCATC-3¢, for RH: sense, 5¢-GCAACGATACCCAGTTTGTC-3¢ and antisense, 5¢-AGTTGACACTTGGCCAGAAC-3¢. The relative amounts of Aly ⁄ REF and RH wereassessed as differences in the threshold of the ampliﬁcationcurve ... T. Oyamada and Ms. T. Hatano for valuable technical assistance. This work wassupported by Grants-in-Aid for Scientiﬁc Research for the Ministry of Education, Science and Culture of Japan (Nos....

Xem thêm

Từ khóa: a framework for the evaluation of text a framework for the design of web service based clinical management systems to support inter and intra organizational patient journeys surface chemistry as a tool for the development of advanced refractory castables tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos a báo cáo khoa học báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản báo cáo khoa học về cá tra báo cáo khoa học nghiên cứu chôm chôm trạng thái hiện sinh báo cáo khoa học biểu tượng văn học báo cáo khoa học Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ