báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgagG K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaaFigure 3 Full-length cDNA and deduced protein of CcGCC1 gene. Start and stop codons are underlined. ... I P Q 541 ctttacatgaaaatgagcatgcaaataagagaggcacttcaattgcagctagaactcgagL Y M K M S M Q I R E A L Q L Q L E L E 601 aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaaK H L H D Q L...

báo cáo khoa học: " Identification of seed proteins associated with resistance to pre-harvested aflatoxin contamination in peanut (Arachis hypogaea L)" ppsx

... knowledge of theirfunctions. Studies to understand host resistance mechan-isms in maize and peanut against A. flavus infection andaflatoxin contamination indicate that proteins are a major factor ... designing the real time PCR primers and data analysis.LL participated in conceiving the study and material preparation. XLparticipated in conceiving the study, data analysis and drafting the manuscript.Received: ... worldwide is aflatoxin contamination,whichisofgreatconcerninpeanutasthistoxincancause teratogenic and carcinogenic effects in animal andhuman. Infection of peanut by Aspergillus flavus occursnot...

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

... ECLfilm (Amersham, USA). As a control, VOPBA of TGEVwas performed in porcine enterocytes using the samemethod as VOPBA of PEDV. To detect the binding of PEDV to pAPN, direct virus-binding studies ... human andporcine coronaviruses, respectively [29]. These facts lead to the speculation that PEDV may gain entry into the enterocytes through APN which is an 150 kDaectoenzyme. But because of the ... to transfect a putative receptor gene into a cell line(nonpermissive cell line) to which the virus can not bindand demonstrate that the cell acquires the ability to bindvirus and be infected through...

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... Mexican origin. The index casewas a 23-year-old female diagnosed with breast carci-noma of the left breast with combined histological fea-tures of lobular carcinoma and infiltrating ductalcarcinoma. ... sarcoma, osteosarcoma, braintumor, pre-menopausal breast cancer, adrenocortical car-cinoma, leukemia, lung bronchioloalveolar carcinoma)prior to the age of 46 years and at least one first- ... the following three databases: International Agency forResearch on Cancer (IARC) database; the Human GeneMutation Database (HGMD), and the P53 Knowledge-base [11,19,20].Cloning To determine the...

báo cáo khoa học: " Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines" docx

... Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, YamamotoT, Lin SY, Antonio BA, Parco A, et al: A high-density rice genetic linkagemap with 2275 markers using a single F2 population. ... which are all very similar in essence:Introgression Lines (ILs) in tomato [11]Brassica napus[16] and Brassica oleracea [17], Stepped Aligned InbredRecombinant Strains (STAIRS) in Arabidopsis ... standard methods to identify QTLs linked to the segregating traits. A QTLanalysis for the evaluated traits was done using both the Figure 6 Characteristic symptoms of the disease "crinkl...

Báo cáo khoa học: "Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea" pps

... (LG0053: 5'-GAACTCATGCAACT-TACCCAGC-3' and LG0052: 5'-GCCAAGACATGATC-CAACGG-3') designed to the 3D region of the genome.None of these samples were positive for the presence of HCoSV-E1. ... struc-tured and contain an internal ribosome entry site (IRES)that directs translation of the RNA by internal ribosomebinding [11]. The 3'-non-translated region also contains a secondary structure, ... to the GenBank nr database by BLASTx and one 395 bpsequence read was identified in this sample that had only55% identity at the amino acid level to its top hit, the VP3protein of Theiler's-like...

Báo cáo khoa học: "Characterisation of a GII-4 norovirus variant-specific surface-exposed site involved in antibody binding" docx

... analysis of the data and drafting and editing of the manuscript. All authors read and approved the final man-uscript.Acknowledgements The authors are grateful to Ian Jones (University of Reading) ... maintaining fitness in the viral population [1]. Mutation in vivo can have a number of effects including increasing the virulence of a virus [2]or acquisition of antiviral resistance [3,4]. An ... editing of the manuscript. PR provided reagents, participated in the coordination of the study and editing of the manuscript.MIG participated in the design and coordination of the study, analysis...

báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

... J,Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Taka-hashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M,Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T,Fujitsuka ... TU in whole*2Lift ATCIS DescriptionACACAC 10 6056 1.353 PRHA BS in PAL1*3ATACACA 5 2124 1.929 PRHA BS in PAL1ATACACAC 3 739 3.326 PRHA BS in PAL1TACACAC 4 1786 1.835 PRHA BS in PAL1CATGTCTC ... which integrates a database and a sys-tem for predicting cis- and trans-elements in mammals [9].Galuschka et al. developed AthaMAP, which includes a program for comparative analysis of cis-elements...

Báo cáo khoa học: "Responses of growth, nitrogen and carbon partitioning to elevated atmospheric CO concentration in live oak 2 (Quercus virginiana Mill.) seedlings in relation to nutrient supply Roberto" pot

... made. Leaf area ratio (LAR; m2·g-1) was cal-culated as the ratio of total leaf area to plant dry weight;specific leaf area (SLA; m2·g-1) was calculated as the ratio ... that total plant leaf areaincreased mainly as a result of accelerated ontogeny[48]. With time, it would be expected that the advantage of overall higher RGR at elevated ... Italy) on5-9 mg of powder of dried samples.2.4. Statistical analysisThree-way analysis of variance (ANOVA) with har-vest time, [CO2] and N availability as the main...

báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx

... resulting in an approximately seven-fold increase in the total amino acid content. The expression of the AS gene, encoding a transaminaseresponsible for the synthesis of asparagine from aspar-tate ... Imai A, Akiyama T, Kato T, Sato S, Tabata S, Yamamoto KT, Takahashi T:Spermine is not essential for survival of Arabidopsis. FEBS Letters 2004,556:148-152.39. Imai A, Matsuyama T, Hanzawa ... photosyn-thetic rate and stomatal conductance were measured to monitor the development of stress. By three days after the cessation of watering, the photosynthetic rate andstomatal conductance of the last...

Xem thêm