0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11 2 deletion syndrome in a 40-year old man: a case report" doc

Báo cáo khoa hoc:

Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report" doc

... purposes)Journal of Medical Case ReportsOpen Access Case report Seizures as the first manifestation of chromosome 22 q11. 2 deletion syndrome in a 40-year old man: a case reportAdriano R Tonelli*1, Kalyan ... with chromosome 22 q11. 2 deletion syndrome can have a variety of brain abnormalities when assessedby neuroimaging. Basal ganglia calcification, similar tothat seen in the patient presented in ... 155:47- 52. 2. Al-Jenaidi F, Makitie O, Grunebaum E, Sochett E: Parathyroid glanddysfunction in 22 q11. 2 deletion syndrome. Horm Res 20 07,67:117- 122 .3. Maalouf N, Sakhaee K, Odvina C: A case of chromosome...
  • 5
  • 254
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCTGAGGAAACCCAGACCCAA, reverse primer CAGTAGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA;Hsp90b, forward primer GCTTGAAGCAAGCCTCGATGCCTGAGGAAGTGCACCATGGA, reverse ... expression in S. cerevisiae was constructed by PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCGACATGCCTGAGGAAACCCAG (SalI site underlined;Hsp9 0a start codon in bold) and the ... regulatesGcn2, the ligand-inducible kinase of the alpha subunit of eukaryotic translation initiation factor 2. Mol CellBiol. 19, 8 422 –84 32 (erratum appears in Mol Cell Biol 20 , 1897). 22 Morano KA, Santoro...
  • 11
  • 427
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Plants as De-Worming Agents of Livestock in the Nordic Countries: Historical Perspective, Popular Beliefs and Prospects for the Future" docx

... carrot (Daucus carota),brassicas (Brassica spp), the onion group (Al-lium spp.), as well as all kinds of berries havehad widespread use against parasites in the Nordic as well as most other countries. ... 55,70 A. ursinum ramson ramslök ramsløk * rams-løg karhunlaukka bjarnarlaukur M H W 34Asparagus of cinalis asparagus sparris asparges asparges * ruokaparsa M 9Iris pseudocorus iris svärdslilja ... farm livestock organically are well aware of the importance of nematode parasites affecting the productivity of their animals and adoptgrazing strategies aimed at evading, or mitigat-ing the...
  • 14
  • 377
  • 0
Tài liệu Báo cáo khoa học: nsights into the reaction mechanism of glycosyl hydrolase family 49 Site-directed mutagenesis and substrate preference of isopullulanase doc

Tài liệu Báo cáo khoa học: nsights into the reaction mechanism of glycosyl hydrolase family 49 Site-directed mutagenesis and substrate preference of isopullulanase doc

... CCGGTGGTcGAcTTTGGTTtcACGCCCSalIE273Q ACGTACTGCTgTCCGGAAAGtACtCCATGGCCGCScaID353N TCCAATCCGTtAGTCTGgCCaTAGAACGCGCMscIE356Q GGAGAATGGTgCCAGGGTACATTTcCAATCCGTCAKpnID372N AATACATCTTaAGGCCGTCGTtGTCGGTGTGG A IID373N ... [48] and A. nidulans [49], isomaltose andpanose are known as effective inducers for amylasesynthesis. In the case of A. nidulans, a mylase synthes is isinduced at an extremely low concentration ... Yokota, T., Tonozuka, T., Kamitori, S. & Sakano, Y. (20 01) The deletion of amino-terminal d omain in Thermoactinomyces vulgarisR 47 a- amylases: Effects of domain N on activity, specificity,stability...
  • 8
  • 551
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc

... percent of the data in the SLs; the lack of significant differences between the AMs after approx. 50% of the data in the SLshave been examined; and the lack of significantdifferences between the measures ... simple-best approaches arenot suitable for a qualitative evaluation of lexi-cal association measures, mainly for the follow-ing reasons: the instability of precision values ob-tained from the first ... than amonglow-frequency data. (2) The evaluation strategies applied: Instead of examining only a small sample of -best can-didates for each measure as it is common practice,we make use of recall...
  • 8
  • 516
  • 0
Báo cáo khóa học: Insight into the activation mechanism of Bordetella pertussis adenylate cyclase by calmodulin using fluorescence spectroscopy pptx

Báo cáo khóa học: Insight into the activation mechanism of Bordetella pertussis adenylate cyclase by calmodulin using fluorescence spectroscopy pptx

... site in both the uncomplexed AC and the AC–CaM complex.Dynamics of the AC catalytic domain as probedby acrylodanTaking advantage of the absence of Cys residues in the native AC protein, the insertion ... differencebetween AC and AC–CaM is the increased ratio of bound/free Ant-dATP in the latter as detected by the CaM-inducedincrease in the relative amplitude of the long lifetimecharacteristic of the bound ... resulting in plasmid pHL 12- 2.For the production of recombinant proteins, strainBL21(DE3)/pDIA17/pHSP247 or BL21(DE3)/pDIA17/pHL 12- 2 was grown in a fermentor at 37 °Cin2YTmedium containing kanamycin...
  • 13
  • 409
  • 0
Báo cáo khoa học: Bacitracin inhibits the reductive activity of protein disulfide isomerase by disulfide bond formation with free cysteines in the substrate-binding domain pptx

Báo cáo khoa học: Bacitracin inhibits the reductive activity of protein disulfide isomerase by disulfide bond formation with free cysteines in the substrate-binding domain pptx

... formation between the Fig. 1. Separation of bacitracin analogs. (A) Structures of the most abundant bacitracin analogs of commercial bacitracin mixtures including the amino-thiazoline ring (a) and ... nm (Fig. 2A E). The kinetics of this reaction were biphasic, with an initial lag phase fol-lowed by an exponential increase in turbidity. In each case, the presence of the bacitracin analog resulted ... Bacitracin A makes up approximately 70% of the total mass of com-mercial bacitracin and, together with bacitracin B1, B2and B3, accounts for more than 96% of total antimicro-bial activity in...
  • 10
  • 626
  • 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

... 5¢-CAGAACCACCACCCCCTGAGGAGACGGTGACTGAGGATCC-3¢; primer 3, 5¢-CACCCAAGCTTGCCACCATGCAGGTTACTCTGAAAGAGTC-3¢; primer 4, 5¢-CACCCAAGCTTGCCACCATGAAATGCAGCTGGGTTATCTTC-3¢; primer 5, 5¢-CAGAACCACCACCCCCTGAGGAGACGGTGACTGAGGTTCC-3¢; ... FEBS(EQKLISEEDL) was generated as follows: coding linkercontaining a NotI site at the 5¢ end of the linker (5¢-GGCCGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAGGACCTGTAG-3¢) and noncoding linker containing anEcoRI ... in the correctinitiation and amplification of the signaling reaction.WASP is an adaptor molecule containing multipledomains: for example, a GTPase-binding domain,which is thought to interact...
  • 14
  • 493
  • 0
Báo cáo khoa học: Principles behind the multifarious control of signal transduction ERK phosphorylation and kinase/phosphatase control potx

Báo cáo khoa học: Principles behind the multifarious control of signal transduction ERK phosphorylation and kinase/phosphatase control potx

... about the control of intracellularsignaling? Its pathways, such as the MAPK cascades,are often composed of kinase and phosphatase pairs.But how important are the kinases and phosphatasesrelative ... light on the control of kinases and phosphatases on signal transduction [22 ].For instance, it was predicted that, in a protein kinasesignaling pathway, kinases mainly control signalingamplitude, ... second kinase in the cascade determines the time dependence of the activity of the third kinase, we varied the Vmax of the secondkinase reaction and recalculated the concentration of the active...
  • 15
  • 434
  • 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

... the hPAHÆadrenaline/dopamine binary complex [17] was superimposed onto that of the ligand-free rPAH containing the regulatory andcatalytic domains [19] the catecholamine main-chain is alsoFig. ... of the full-length wt-hPAH was measured as a function of L-Pheconcentration and a steady-state (3 min response) bindingisotherm was obtained [26 ,27 ]. The isotherm observed in the absence of ... that the rate of phosphorylation is indeeddependent on the extent of deamidation of a very labile Asnresidue (Asn 32) in the N-terminal autoregulatory sequence of wt-hPAH [34].Dopamine has a...
  • 10
  • 470
  • 0

Xem thêm

Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ