0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" doc

báo cáo khoa học:

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" doc

... with low back pain after history taking and physical exam in uncomplicated, radicular and complicated back pain instead of making an anatomical diagnosis is reasonable92 5 3 ∅The majority of ... in clinical studies: Effects of a media campaign on back painbeliefs and its potential influence on management of low back pain in general practice. Spine 2001, 26:2535-42.25. FORIS: Database ... of 6(page number not for citation purposes)Implementation ScienceOpen AccessResearch article Acceptance and perceived barriers of implementing a guideline for managing low back in general...
  • 6
  • 350
  • 0
báo cáo khoa học:

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" pdf

... with low back pain after history taking and physical exam in uncomplicated, radicular and complicated back pain instead of making an anatomical diagnosis is reasonable92 5 3 ∅The majority of ... article Acceptance and perceived barriers of implementing a guideline for managing low back in general practiceJean-François Chenot*1, Martin Scherer1, Annette Becker2, Norbert Donner-Banzhoff2, ... disseminated. 86 14 ∅∅I have been treating low back pain according to the guideline previously. 39 54 7 ∅The guideline has changed my management of low back pain. 13 43 34 10Triaging patient...
  • 6
  • 401
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

... isolates in group I had a distant relation to vaccine strains used in Thailand including Ma5, H120, M41, and Connecticut. New serotypes or variant strains can emerge as a result of only a few changes ... in Thailand. Although many different strains of live attenuated and inactivated vaccines have been widely used to control IB, the outbreaks of the disease have continued to be a problem in ... and deduced amino acid sequences were determined and compared among each other and with other IBV strains published in the GenBank database. Group I Thai IBV isolates had nucleotide and amino...
  • 5
  • 537
  • 0
báo cáo khoa học:

báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf

... yeast copper-uptake mutant and plasmids and Dr. David Eide of University of Wisconsin-Madison and Dr. Hongsheng Zhang of NanjingAgricultural University for providing yeast iron-uptake mutant and ... interactions of COPTs.AIg5, a transmembrane protein with C terminal in the cytoplasm;NubI, N-terminal half of ubiquitin protein; NubG, mutated N-terminalhalf of ubiquitin protein; Cub, C-terminal half ... and gene expression analyses and drafted the manuscript. XL and JX provided biochemical and molecularanalysis supports. SW contributed to data interpretation and to writing themanuscript. All...
  • 12
  • 334
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Hardware Architecture of Reinforcement Learning Scheme for Dynamic Power Management in Embedded Systems" docx

... that can balance the workload against power. This paperfocuses on implementing an intelligent Power Manager thatcan change policy according to workload.3.2. Reinforcement learning A general ... policy) basedon observations of the workload. It can be modeled as a power state machine, each state being characterized by thelevel of power consumption and performance. In addition,state transitions ... Power Management in Embedded SystemsViswanathan Lakshmi Prabha1 and Elwin Chandra Monie21Department of Electronics and Communication Engineering, Government College of Technology, Coimbatore...
  • 6
  • 268
  • 0
báo cáo khoa học:

báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot

... theconception and design of the study, the analysis and inter-pretation of data, and has been involved in drafting and critically revising the manuscript for important intellec-tual content. MK has made ... design of the study and planning of the work that led to the manuscript, the acquisition, and interpretation of data, and has been involved in drafting and critically revising the manuscript for ... think of breast cancer surgery in day care. Also, the cooperation of the ward nursing staff and management was considered highly important.Cooperation of patients and patient organizations wasconsiderably...
  • 12
  • 483
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... 689–695.42 Vitagliano L, Adinolfi S, Riccio A, Sica F, Zagari A &Mazzarella L (1998) Binding of a substrate analog to a domain swapping protein: X-ray structure of the com-plex of bovine seminal ribonuclease ... structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department of Biology and...
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D ... AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation of cytosolic 5¢-nucleotidase R. Pesi et al.4870 ... GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG...
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465.9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T,Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007)PRTFDC1, a ... for nucleotide formation with guanine and hypoxanthinebases, respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the purine base and Asp137 was observed ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and...
  • 11
  • 770
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ