báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

... purposes) Implementation ScienceOpen AccessResearch article Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for ... approach for diagnostic analysis. The combination of qualitative and quantitative data were able to capture multiple perspectiveson barriers and facilitators to change. These data informed the ... combination of methods identified a complex mix of organisational, teamwork, and specific assessment- relatedfactors as barriers and facilitators for change. Organisational factors are acknowledged...

báo cáo khoa học: "Measuring organizational readiness for knowledge translation in chronic care" potx

... r elated measurementtools synthesized in a concept map; a set of core mea-sures for assessing OR for KT that will be available in a database and a searchable website; and a validated OR for ... of Political Science, Université Laval, Québec, Canada.5Faculty of Nursing,University of Alberta, Edmonton, Alberta, Canada.6Ottawa Hospital ResearchInstitute, Ottawa, Canada.7Faculty of Medicine, ... measures of organizational determinants in KT inchronic care services. We are particularly aiming at assessment tools based on theorizing about organizational readiness (OR) that would be used to assess...

Tài liệu Báo cáo khoa học: "An Improved Parser for Data-Oriented Lexical-Functional Analysis" doc

... the performance of the simple RF estimator against the discounted RF estimator. Furthermore, wewant to study the contribution of generalizedfragments to the parse accuracy. We thereforecreated for each ... representation for utterance analyses,• a set of decomposition operations that divide a given utterance analysis into a set of fragments,Note that the computation of the competition probability in the above ... Kaplan, and J. Bresnan, 1982. "Lexical-Functional Grammar: A Formal System for Grammatical Representation", in J. Bresnan(ed.), The Mental Representation of Grammatical Relations, The...

Báo cáo khoa học: "Stereotactic body radiotherapy for stage I lung cancer and small lung metastasis: evaluation of an immobilization system for suppression of respiratory tumor movement and preliminary results" ppsx

... Hospital, Nagoya, Japan, 3Nagoya Radiosurgery Center, Nagoya Kyoritsu Hospital, Nagoya, Japan and 4Department of Radiation Therapy, Aizawa Hospital, Matsumoto, JapanEmail: Fumiya Baba* - fbaba@bd5.so-net.ne.jp; ... 2008,70:1229-1238.22. Sasai K, Ono K, Hiraoka M, Tsutsui K, Shibamoto Y, Takahashi M,Hamakawa J, Nadai C, Abe M: The effect of arterial oxygen con-tent on the results of radiation therapy for epidermoid ... linear accelerator (CLINAC 23EX,Varian Medical Systems, Palo Alto, California, USA) with6-MV photons. The planned dose was 44 Gy in 4 fractions for tumors with a maximum diameter of less than...

Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx

... gene.ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATTZ. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channelFEBS Journal 276 ... interdomain ﬂexibility isanother reason for the scarcity of structural data,because of their negative effects on the diffraction qual-ity of protein crystals. Therefore, replacement of the ori-ginal ... indicator used by the program is the root mean square deviation of the overlapping atomsat the spliced site. The coordinates of the best splicedstructure for each fusion candidate were then...

Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

... 5'-CATCTTCTCAAAATTCGAG-3'Antisense 5'-TGGGAGTAGACAAGGTACAACCC-3'Mouse IL-1β Sense 5'-CAACCAACAAGTGATATTCTCCATG-3'Antisense 5'-GATCCACACTCTCCAGCTGCA-3'Mouse ... 5'-GTCTCCTACCAGACCAAG-3'Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3'Human β-actin Sense 5'-TTCCTGGGCATGGAGTCCT-3'Antisense 5'-AGGAGGAGCAATGATCTTGATC-3'Mouse TNFα ... 5'-GATCCACACTCTCCAGCTGCA-3'Mouse IL-6 Sense 5'-CACTTCACAAGTCGGAGGCTTA-3'Antisense 5'-GCAAGTGCATCATCGTTGTTG-3'Mouse β-actin Sense 5'-AGAGGGAAATCGTGCGTGAC-3'Antisense 5'-CAATAGTGATGACCTGGCCGT-3'TNFα,...

báo cáo khoa học: " Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis)" potx

... were automatically determinedand then all plots were manually verified. Ambiguouscalls were given an N in the data to indicate that noSNP was reliably determined. To assess the accuracy and ... base calls for allSNPs, determined standard genetic statistics such as jSTor jPTvalues and analyses of mole cular va riance(AMOVA) [41] and exported formatted data for subse-quent analyses ... Food and Agriculture Organization of the United Nations, FAOSTAT.http://faostat.fao.org.10. Vavilov NI: The origin, variation, immunity and breeding of cultivatedplants. Waltham, MA: Chronica...

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitaminD3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce2 0a, 22R-dihydroxycholesterol ... which they arose by the action of P450scc, as well as the products that they gave rise to. This revealed both the major and minor pathways for the metabolism of vitamin D3 by P450scc.ResultsMetabolism ... School of Biomolecular, Biomedical and Chemical Sciences, The University of Western Australia, Crawley, Australia2 Department of Pharmaceutical Sciences, College of Pharmacy, University of Tennessee...

Tài liệu Báo cáo khoa học: "Translation Model Adaptation for Statistical Machine Translation with Monolingual Topic Information" doc

... 2007.Bilingual LSA-based adaptation for statistical machinetranslation. Machine Translation, pages 187-207.Nicola Uefﬁng, Gholamreza Haffari and Anoop Sarkar.2008. Semi-supervised Model Adaptation for ... sentences.When the translated texts and the training data comefrom the same domain, SMT systems can achievegood performance, otherwise the translation qualitydegrades dramatically. Therefore, it is of ... domain adap-tation in SMT can be classiﬁed into translation mod-el adaptation and language model adaptation. Herewe focus on how to adapt a translation model, whichis trained from the large-scale...

Tài liệu Báo cáo khoa học: "Conditional Random Fields for Word Hyphenation" docx

... 90% of the dataset us-ing PATGEN, and then hyphenate the remaining10% of the dataset using Liang’s algorithm and the learned pattern ﬁle. The PATGEN tool has many user-settable pa-rameters. As ... all paths that do have a hyphen at this position, divided by the sum of the weights of all paths. The forward-backwardalgorithm uses the sum operator to compute the weight of a set of paths, ... athttp://www.talo.nl/talo/download/documents/Language_Book.pdf.374we show that CRFs can achieve extremely goodperformance on the hyphenation task.2 History of automated hyphenation The earliest software for automatic...

Xem thêm