0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx

báo cáo khoa học:

báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx

... of the Department of Veterans Affairs has stated that he will return any financial saving reaped by increased use of thiazide-based regimens to the VA medical center that generated them. Section ... purposes)Implementation ScienceOpen AccessResearch article A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertensionCarol M Ashton*1,2,3,4, ... phaidet@bcm.tmc.edu; Barbara Kimmel - barbara.kimmel@med.va.gov; Anna Kolpakchi - kolpakchi.annal@med.va.gov; Lee B Lu - lblu@bcm.tmc.edu; Aanand D Naik - anaik@bcm.tmc.edu; Laura A Petersen - laurap@bcm.tmc.edu;...
  • 13
  • 344
  • 0
báo cáo khoa học:

báo cáo khoa học: "Applying mass spectrometry based proteomic technology to advance the understanding of multiple myeloma" ppt

... theoretically there is no limit to the number of samples that can be compared whereas with isotope labeling such as iTRAQ a maximum of 8samples can be compared at a time. Another advantage of the label ... dysregulation, anemiaand susceptibility to infections. The median age at diag-nosis of MM is 62 years for men and 61 years for women, with less than 2% of those diagnosed at an age less than40 years. ... clinical management of breast cancer. Plasma-based proteomics in early detection and therapy. Breast Cancer Res 2006, 8:217.63. Faca V, Krasnoselsky A, Hanash S: Innovative proteomic approaches for...
  • 11
  • 283
  • 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... in the biodegradation of a n a lmost unlimited spectrum of naturaland man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatestdetail is the pathway of ... Germany), 0.007%(w/v) o-dianisidine (Sigma) and 10 lgÆmL)1 of MABO. The reaction was initiated by the addition of substrate, and the increase in absorption at 430 nm caused by the oxidation of o-dianisidine ... 5¢-GCCTGCGGCGGCCCAAGAGGTGCC-3¢ for the H6 7A mutant, by using the primer pair 5¢-GCAGCGGCACCTCTTCTCACGCCGCAGGCTTG-3¢ and 5¢-CA AGCCTGCGGCGTGAGAAGAGGTGCCGCTGC-3¢ for the W66S mutant, and by using the primer...
  • 8
  • 647
  • 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... change in the supra-molecular organization of the peripheral antenna. The absence of LHCII oligomers in these strains leads to the accumulation of LHCII monomers that presumably trans-fer their ... to a particular stability of itsconformation mediated by saturated fatty acids of boundary lipids [47]. Later, PG was proposed to anchorD1 into the thylakoid membranes of cyanobacteria by a strong ... wish to thank A. El Maanni for her participation in pmfstrains selection. We are grateful to Prof. R. Bassi for the gift of antibodies to LHCII. We thank R. Boyer for the photographic picturesand...
  • 10
  • 411
  • 0
Báo cáo khoa học: A di-leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein doc

Báo cáo khoa học: A di-leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein doc

... per-meabilization step was omitted. Cells were stained with a mouse IL2RA antibody followed by an Alexa 488-conju-gated goat secondary antibody.Western blot analysis For analysis of the total wt and ... IL2RA, and rat Mycantibodies were purchased from Stressgen (Ann Arbor, MI,USA), Zymed Laboratories (South San Francisco, CA,USA), BD Biosciences (San Diego, CA, USA), Upstate(Lake Placid, ... exhibits a steady-state localizationin the Golgi apparatus and an unknown vesicle com-partment in the stably transfected CHO cells and the disruption of a di-leucine signal in the variable loopregion...
  • 12
  • 374
  • 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

... Haematolog-ica 89, 1332–1340.42 Naito K & Fujikawa K (1991) Activation of humanblood coagulation factor XI independent of factor XII.Factor XI is activated by thrombin and factor XIa ... can activate FXI, i.e.activated factor XII (FXIIa), FXIa, and thrombin, the main physiologic activator is actually thrombin formedon the surface of activated platelets [6–8]. Cleavage at the ... by FXIa. The Michaelis parameters, kcatand Km, were calculated on the basis of known concentration of wild-type and mutantFXIa and using the program grafit (Erithacus SoftwareLtd., Staines,...
  • 11
  • 563
  • 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

... normal and mismatch primersare shown in Fig. 10C. Radioactivity in the trichloro-ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG ... FEBSTTCGAACGTACGGACGTCCA…5’TTCGAACGTACGGACGTCCA…5’TTCGAACGTACGGACGTCCA…5’3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGG5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT(-20 downstream oligo)3’3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGG5’ ... Seto H, Hatanaka M, Kimura S, Oshige M, Tsuya Y,Mizushina Y, Sawado T, Aoyagi N, Matsumoto T,Hashimoto J et al. (1998) Purification and characteriza-tion of a 100 kDa DNA polymerase from cauliflowerinflorescence....
  • 19
  • 350
  • 0
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

... denaturing effects of ureaArnab Mukherjee, Manas K. Santra, Tushar K. Beuria and Dulal PandaSchool of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, IndiaOrganisms, including ... GTP and the intensity of light scattering wasmonitored for 15 min at 37 °C.Effect of TMAO on the GTPase activity of FtsZ A standard malachite green ammonium molybdate assaywas used to measure ... Natl AcadSci USA 95, 9268–9273.51 Arakawa T & Timasheff SN (1984) The mechanism of action of Na glutamate, lysine HCl, and piperazine-N,N¢-bis (2-ethanesulfonic acid) in the stabilization...
  • 13
  • 599
  • 0
Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

... esaKGPmiCLGPTAPDAP6GDHesaLGPOGP6OC2URP5PDANHSG2GGSSHPDANSGxoHGRGSSP5RP5XP7SAGP3P6FP4EKTIT A IP5REP5uXKTIIAGP3GP2MGPPDAPT A PEPNEKPPDAPTARYPtxeRYPsn a rtRYPCALCALetxC A LtrasnHDLHDAND AN NEDAIENPPRPTRPDAPMAPMIODAONIPMADACUNADACUNXPYHPPRPTRPGHP1RXPYHetxP5RMRPysPPRPnPT A PMAPTAKAPDAPD A PMApAKesaPNPPTAPDA a N+ aN +kaelaNK+K+k a elKKaNaPT A seenarbmemMAStxeMAS2HHASodA-SHycTMYCH1HHASobiRoteK'3escAcYCHFPKHDP6LGXHartnsccAteM++Fig. ... all require AK but not ADPR transferase.Six out of 12 modes require ADA, AK and PNPaseand another three require AK and PNPase but notADA. The modes in the presence of SAHH2 and MT(Table 4) do ... leading from IMP to AMP[8].From our theoretical analysis, a hitherto rarely dis-cussed feature of the salvage pathways becomes trans-parent and understandable. This is the high number of ATP...
  • 13
  • 476
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ