báo cáo khoa học: "An 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance: a case report" ppsx

Báo cáo khoa học: "An Extensible Architecture for Integrating Natural Language Processing Techniques with Wikis" docx

... integrates extractive text summariza-tion methods such as LexRank (Erkan and Radev,2004).Highlighting Keyphrases Another approach toassist users in better grasping the idea of a wiki pageat a ... Re-search, 22:457–479.David Ferrucci and Adam Lally. 2004. UIMA: An Ar-chitectural Approach to Unstructured Information Pro-cessing in the Corporate Research Environment. Nat-ural Language ... segmentation. In Proceedings of the1st Meeting of the North American Chapter of the As-sociation for Computational Linguistics, pages 26–33.Hamish Cunningham, Diana Maynard, KalinaBontcheva, and...

Báo cáo khoa học: An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion pptx

... dermaseptin S9. FEBS J 275, 4134–4151.41 Simmaco M, Mangoni ML, Boman A, Barra D &Boman HG (1998) Experimental infections of Ranaesculenta with Aeromonas hydrophila: a molecularmechanism ... ThT-binding capabil-ity, similar to the metastable aggregates of aDrs. Inter-estingly, the same behaviour was observed for a C-terminally amidated aDrs (aDrsa) (data not shown).However, C-terminal amidation ... headgroup. By contrast,SDS micelles favour an initial interaction of cationicantibacterial peptides by electrostatic attraction in a similar manner to negatively charged bacterial cellmembranes [9,11]....

báo cáo khoa học: "An 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance: a case report" ppsx

... CAS E REP O R T Open AccessAn 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance: a case reportStavros Sfoungaristos1, Ioannis S Katafigiotis2*, ... Katafigiotis2*, Stavros I Tyritzis2, Adamantios Kavouras1, Panagiotis Kanatas3,Anastasios Petas4AbstractIntroduction: Ductal adenocarcinoma is a rare variety of the common acinar adenocarcinoma. It ... features.Cancer 2002, 94:2610-2617.doi:10.1186/1752-1947-5-4Cite this article as: Sfoungaristos et al.: An 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance:...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... Authors Journal compilation ª 2009 FEBS 127An anthrax lethal factor mutant that is defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy ... K518E and E682G (Fig. 1A) . Lys518is within a patch of amino acids that has previouslybeen implicated in binding MAPKKs [22]. Glu682 iswithin an a- helix that also contains the amino acids A BFig. ... from Upstate (Lake Placid, NY,USA). Antibody raised against the N-terminus ofMAPKK2 (catalog no. 610235) was obtained from BD Bio-sciences (San Jose, CA, USA). Antibodies raised againstthe...

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... intramolecular interactions, allowingaccess to the AD. As the autoinhibition affected anunrelated AD when this was put in place of the nativeMeis2d AD, it appears that any intramolecular interac-tions ... The Authors Journal compilation ª 2010 FEBSL3 -A mutant with Pbx 1a was reduced by at least asmuch as that of the previously described LL-AAmutant. Additionally, the EEK -A mutant was some-what ... presumably because of itsdecreased interaction with Pbx 1a. These data suggestthat interaction with Pbx 1a and the autoinhibitoryactivity are separable functions.Alternative splicing of Meis3 affects...

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... 5¢-GAATTCTAATACGACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢;8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCGGGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCCGAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) were pre-pared by automated ... includingthe ease of RNA substrate and DNAzyme synthesiswithout any chemical modification, and convenient useof RNase A as a common bioreagent, an attractiveproperty for DNAzymes that have various applications.In ... automated synthesis, and purified by 16%denaturing PAGE (Sangon, Shanghai, China). The RS(5¢-gaggcagguauu-3¢) was also prepared by automated syn-thesis and purified by HPLC (TaKaRa, Dalian, China).[32P]ATP[cP]...

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... Entomol 51,1–24.7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY& Ishizaki H (1986) Amino acid sequence of a protho-racicotropic hormone ... insects.Experimental proceduresAnimals A racial hybrid of B. mori, Kinshu · Showa (Ueda Sanshu,Ueda, Japan), was used. Larvae were reared as previouslydescribed [38]. Pupae initiated adult development 1 dayafter ... HF & Grunert LW (2002) Bombyxin is a growth factor for wing imaginal disks in Lepidoptera.Proc Natl Acad Sci USA 99, 15446–15450.30 Satake S, Masumura M, Ishizaki H, Nagata K,Kataoka H,...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... migratedas a single band on SDS–PAGE, with an apparentmolecular mass of 57–59 kDa, depending on the acryl-amide concentration used (Fig. 1A) . Western blottinganalyses of the intact as well as ... E & Hisabori T (2001) ATPsynthase – a marvellous rotary engine of the cell. NatRev Mol Cell Biol 2, 669–677.4 Sambongi Y, Iko Y, Tanabe M, Omote H, Iwamoto-Kihara A, Ueda I, Yanagida T, ... source-depen-dent variation.Discussion A critical and long-standing question in (bacterial) bio-energetics is whether the ratio of translocated ions toATP for a given ATP synthase is a ﬁxed value. Thisvalue...

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts were harvested ( 1a, carcinoma ... membrane-blebbing assay, we evaluated the activityof the mutant with the tail deletion (Flag-TD; s-DAPK-1Dtail) and the protease-resistant substitution (Flag-TM1; s-DAPK-1G296AR29 7A) . As compared ... s-DAPK-1Dtail with a 42amino acid tail deletion is named Flag-TD. (B–D) Transfected s-DAPK-1 and its mutants identiﬁed a cleavage within its tail. HCT116p53+ ⁄ +cells were transfected with...

Xem thêm