Báo cáo y học: " Early finding of chest wall metastasis of hepatocellular carcinoma in a woman by fluorodeoxyglucose-positron emission tomography scan: a case report" doc
Báo cáo y học: " Early finding of chest wall metastasis of hepatocellular carcinoma in a woman by fluorodeoxyglucose-positron emission tomography scan: a case report" doc
... carcinoma recurrence. Anticancer Res 2005, 25:4719-4725.doi:10.1186/1752-1947-5-147Cite this article as: Yang et al.: Early finding of chest wall metastasis of hepatocellular carcinoma in a woman by fluorodeoxyglucose-positron emission ... potentially valuable method to screen for the early presentation of extrahepatic metastatic disease. Case presentation A 45-year-old Asian woman with a known history of hepa-titis C for 20 years had ... Nam BH: A prospective evaluation of 18F-FDG and11C-acetate PET/CT fordetection of primary and metastatic hepatocellular carcinoma. J NuclMed 2008, 49:1912-1921.16. Sugiyama M, Sakahara...
- 3
- 309
- 0
Báo cáo y học: "Early Differential signaling mechanisms regulate expression of CC chemokine receptor-2 during monocyte maturatio" ppsx
... 5'CCACATCTCGTTCTCGGTTTATCAGCCR2 antisense 5'CGTGGAAAATAAGGGCCACAGCCR3 sense 5'CACTAGATACAGTTGAGACCTTTGGCCR3 antisense 5'GGTAAAGAGCACTGCAAAGAGTCCCR4 sense 5'ACCCCACGGATATAGCAGATACCCCR4 ... 5'ACCCCACGGATATAGCAGATACCCCR4 antisense 5'CGTCGTGGAGTTGAGAGAGTACTTGCCR5 sense 5'GGAGCCCTGCCAAAAAATCCCR5 antisense 5'CTGTATGGAAAATGAGAGCTGCCCR6 sense 5'TGGCAAGGGGTATAATTTGGGCCR6 antisense ... 5'AGTATATACACTTCAGATAACCXCR4 antisense 5'CCACCTTTTCAGCCAACAGCXCR5 sense 5'CTGGACAGATTGGACAACTACXCR5 antisense 5'CATCACAACAACTCCCTGAGAPDH sense 5'TCCATGACAACTTTGGTATCGGAPDH antisense 5'GTCGCTGTTGAAGTCAGAGGA...
- 14
- 285
- 0
Báo cáo y học: "Early Migrating leukocytes are the source of Peroxiredoxin V during inflammation in the airway" potx
... and neg-ative. Likely, PAO1 caused activation of RAWs andpossibly apoptosis of these cells. Activated RAWs releasean array of pro-inflammatory cytokines, which might ini-tiate apoptosis in ... pri-mates. Am J Respir Cell Mol Biol 2001, 25:226-232.24. Tomoaki Hoshino, Hajime Nakamura, Masaki Okamoto, Seiya Kato,Shinichi Araya, Keiko Nomiyama, Kotaro Oizumi, Young HA, Hisam-ichi Aizawa, ... mRNA as well as protein expression and secretion.We found that both in vivo and in vitro inflammationinduced by bacteria resulted in an increased expression of PRXV in the airway epithelium by...
- 12
- 446
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... C., Gaykema R.P., Holguin A. , Martin D., Maier S.F., Watkins L.R. Intrathecal HIV-1 envelope glycoprotein gp120 induces enhanced pain states mediated by spinal cord proin-flammatory cytokines. ... of treating neuropathic pain by inhibiting TLR4. Our results demonstrated that in- trathecal siRNA-mediated suppression of TLR4 attenuated CCI-induced mechanical allodynia and thermal hyperalgesia ... Department of Anesthesiology, Changhai Hospital, Second Military Medical University, Shanghai 200433, China 3. Institute of Thoracic Cardiac Surgery, Changhai Hospital, PLA, Shanghai 200433, China ...
- 9
- 487
- 0
Báo cáo y học: "Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation model" potx
... 5Research articleImproved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation modelJarno van de Breevaart Bravenboer1, Caroline D In der Maur2, ... surrounding healthy cartilage. Variable andsuboptimal wound healing and integration may be a cause of potential failure of otherwise promising techniques.Injury to cartilage results in the formation ... testIntroductionLocalized articular cartilage defects are a major problem fororthopaedic surgeons. Because cartilage has poor abilityto heal because of lack of intrinsic repair capacity [1-3],chondral...
- 8
- 477
- 0
Báo cáo y học: " mGluR5 positive modulators both potentiate activation and restore inhibition in NMDA receptors by PKC dependent pathway" docx
... receptors by agonistsincreases hydrolysis of membrane phosphoinositide (PI)via activated phospholipase C, leading to f ormation of diacylglycerol (DAG), which activates protein kinase C(PKC) and inositol-1,4,5-trisphosphate ... channelspermeable to cations and are classified as a- amino-3-hydroxy-5-methyl-4-isoazolepropionic acid (AMPA),kainite, and N-methyl-D-aspartate (NMDA) receptorsbased on agonist preference. Metabotropic ... futureexperiments.Preparation of hippocampal slicesThe NMRI mice were sacrificed by decapitation afteranesthesia, and the whole brain was carefully removed.The brain was t hen immediately soaked in ice-cold andoxygenated...
- 9
- 601
- 0
Báo cáo y học: "Offensive’ snakes: cultural beliefs and practices related to snakebites in a Brazilian rural settlement" docx
... substance as anantivenom is both historically ancient and geographicallyTable 3 Charms related to snakebites, according to the inhabitants of the county of Pedra Branca, Bahia State, Brazil.Charms ... total popu-lation for the entire municipality of Santa Terezinha was9.914 inhabitants [20].Living in a basically rural area, the population of PedraBranca depends on the cultivation of cassava ... Jararaca-malha-de-sapo, jararaca-quatro-ventasWhitetail lancehead41 100Crotalus durissus cascavella (Wagler, 1824) CascavelRattlesnake40 100Bothrops leucurus (Wagler, 1824) Jararaca-cabo-brancoWhitetail...
- 13
- 461
- 0
Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf
... bypass and after LVAD activation [12,13]. Alter-natively, manual occlusion of the pulmonary arteryshortly before activatio n of the LVAD by the surgeonand transesophageal echocardiography studies ... familialdilated cardiomyopathy. Recompensation was notachieved despite maximum medical therapy and inser-tion of an intra-aortic balloon pump. BVAD [Excor, Ber-lin Heart, Berlin, G ermany] was implanted ... monthspostpartum on a cardiac biventricular assist device (BVAD) as bridge to heart transplantation with delayed onset of intracardial shunting and subsequent hypoxemia due to massive pulmonary embolism....
- 4
- 379
- 0
Báo cáo y học: " Recurrent burner syndrome due to presumed cervical spine osteoblastoma in a collision sport athlete – a case report" potx
... blastic appearance to the posterior arch of the atlas. A Torg ratio [5] (ratio of canal diameter divided by verte-bral body diameter on a lateral plain cervical radiograph) of 1 was measured at ... Vaccaro - alexvaccaro3@aol.com* Corresponding author AbstractWe present a case of a 35-year-old active rugby player presenting with a history of recurrentburner syndrome thought secondary ... developmental lesions involving theaxial skeleton most frequently includes plain radiographs,followed by CT for assessment of bony matrix and MRI forevaluation of intrinsic spinal cord parenchymal...
- 5
- 378
- 0
Báo cáo y học: " Congenital hepatic fibrosis leading to cirrhosis and hepatocellular carcinoma: a case repor" pptx
... CAS E REP O R T Open AccessCongenital hepatic fibrosis leading to cirrhosisand hepatocellular carcinoma: a case reportMohammad Reza Ghadir1*, Mohammad Bagheri2and Amir Hossein Ghanooni1AbstractIntroduction: ... broad spectrum of clinical diseases which areusually accompanied by hepatic involvement. Hepatocellular carcinoma (HCC) is a rare complica-tion of CHF with only a few previous cases reported.We ... the patientfor publication of this case report and any accompany-ing images. A copy of the written consent is availablefor review by the Editor -in- Chief of this journal.AbbreviationsAFP: alpha...
- 4
- 312
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP