Báo cáo y học: " Coexistence of a colon carcinoma with two distinct renal cell carcinomas: a case report" pps

... al. [4] Renal cell carcinoma Other sites Beisland et al. [5] Renal cell carcinoma Esophageal carcinoma Kobayashi et al. [6]Papillary renal carcinoma Heart liposarcoma Gałazka et al. [7] Renal ... gallbladder Morelli et al. [15] Renal cell carcinoma Papillary renal carcinoma/ chromophobe cell carcinoma Petrolla et al. [16] Renal cell carcinoma Malignant lymphoma Yagisawa et al. [17]Transitional ... Reference Renal cell carcinoma Colorectal carcinoma Halak et al. [2] Renal cell carcinoma Gynecological malignancies Cheung Wong et al. [3]Chromophobe cell carcinoma Papillary renal carcinoma Tyritzis...

Báo cáo y học: "Role of positron emission tomography-computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature" pdf

... 1. Case 1 A 14-year-old Caucasian girl presented with a one-yearhistory of cough and gradually progressive dyspnea. Onclinical examination, decreased air entry was noted onthe left side of ... significant uptake. Histological results of a biopsytaken from the mass were suggestive of low-grade MEC. Case 3 A 24-year-old Caucasian man presented with a one-yearhistory of cough and haemoptysis. ... features of low-grade MEC. Case 2 A 21-year-old Caucasian man presented with a one-yearhistory of cough and dyspnea on exertion. CECT of thechest revealed a 10 × 10 mm mass in the right mainbronchus....

Báo cáo y học: " Coexistence of mal de Meleda and congenital cataract in a consanguineous Tunisian family: two case reports" ppsx

... Tunisian family: two case reports Jour-nal of Medical Case Reports 2010, 4:108JOURNAL OF MEDICAL CASE REPORTSBchetnia et al. Journal of Medical Case Reports 2010, 4:108http://www.jmedicalcasereports.com/content/4/1/108Open ... two female siblings aged 45 and 30 years, presented with a clinical association of mal de Meleda and congenital cataract. The two patients exhibited diffuse palmoplantar keratodermas. One of them ... presented with a total posterior subcapsular cataract and had a best corrected visual acuity at 1/20 in the left eye and with the right eye was only able to count fingers at a distance of one foot....

Báo cáo y học: " Coexistence of primary adenocarcinoma of the lung and Tsukamurella infection: a case report and review of the literature" doc

... that uses galactose as a carbon source. Adapted from Tsukamura and Kawakami [2]BioMed CentralPage 1 of 4(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case ... pulmo-nary lesion and the lack of radiographic improvementafter 6 weeks of antibiotic therapy, the patient was againasked and eventually agreed to undergo a percutaneousCT-guided biopsy of the ... the case of an elderly man presenting with fever, hemoptysis and a left upper lobe cavitary lesion. Serial sputum cultures grew Tsukamurella pulmonis, a rare pathogenassociated with cavitary pneumonia...

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... demographic data. Mean age was 68 years old (quartile range: 59-77). The major ethnicities were European American (44%), African American (37%) and Hispanic Ameri-can (11%). Table 1. Demographics ... Our study showed that among those with OAB, only 52% had been diagnosed with or treated for urinary symptoms (OAB, LUTS and/or BPH). Fur-thermore, those with OAB had a worse quality of life ... Dorota Borawski1, William Tran1, Martin H Bluth2 1. SUNY Downstate Medical School, Department of Urology, Brooklyn, NY, USA 2. Wayne State University School of Medicine, Department of Pathology...

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green ﬂuorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... CCATGCCTATGATACTGGGAT-3¢GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢GSTM2-revA ... 4AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8AS-7 GAGTAGAGCTTCATCTTCTC CDS 397–426 – 1AS-8ACTGGTCAAGAATGTCATAA CDS 480–499 – 7AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0AS-10 CAGGCCCTCAAACCGAGCCA ... Netherlands). A horseradish peroxidase-conjugated antirabbit IgG antibodyand an enhanced chemiluminescence assay were purchasedfrom Amersham Pharmacia Biotech. All other chemicalswere of analytical grade.Cloning...

Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx

... placebo-controlled study of Alternaria alternata immunotherapy: Clinical efficacy and safety. PediatrAllergy Immunol 2008, 19:67-75.20. Asturias JA, Ibarrola I, Ferrer A, Andreu C, Lopez-Pascual ... (cat and dog), pollens (mixed grass,olive, Parietaria judaica, Artemisia, Platanus orientalis,Cupresus arizonica and Salsola kali), and moulds ( Alter-naria alternata, Aspergillus fumigatus, ... immunotherapy with a standardized Alternaria extract. JAllergy Clin Imunol 1990, 85:460-472.19. Tabar AI, Lizaso MT, Garcia BE, Gomez B, Echechipia S, Aldunate MT,Madariaga B, Martinez A: Double-blind,...

Báo cáo y học: "Association of ENPP1 gene polymorphisms with hand osteoarthritis in a Chuvasha population" doc

... impressive associationlead was found with the pooled rare alleles of the STR markerM06NR 1A, which was associated with a younger age at onsetby a mean of about 3.5 years (Table 3). The major contributionto ... individualswere all Chuvashians (Caucasians) from small villages in theChuvasha and Bashkirostan autonomies of the Russian Feder-ation. Their population is demographically stable and they havelived ... radiographs.The extent of OA development was evaluated for each of the14 joints of each hand separately, in accordance with thegrading system of Kellgren and Lawrence [19]. The OA evalu-ation was...

Báo cáo y học: "Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase" potx

... thedevelopment of a PEGylated recombinant mammalian uricaseas an orphan drug for treating refractory gout. In a preclinicalstudy, weekly administration of this mammalian PEG-uricasenormalized urate levels ... activity, in 'early elimination' subjects 002, 011, and 013Time course of appearance of IgM and IgG antibodies against PEG-uri- case, and of plasma uricase activity, in 'early elimination' ... uricase catalytic activity but caused a rapid clearance of circulating uricase activity, presumably by crosslinking PEGstrands tethered to the enzyme. We speculate that binding of antibody against...

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

... Similarly, no association wasdetected with RA using haplotype analysis or when stratificationby shared epitope carriage or by presence of rheumatoid factorwas undertaken. This study was powered ... wereinitially selected for investigation because they had all beenassociated with RA in the Japanese population on single-pointanalysis, because the SNPs formed a haplotype associated with RA and ... susceptibility allele frequency with shared epitopeallele carriage or with the presence of rheumatoid factor (Table1). Stratification based on carriage or absence of sharedepitope alleles (data not...

Xem thêm