Báo cáo y học: " Treatment of stasis dermatitis using aminaphtone: Correction:Acquired hemophilia as the cause of life-threatening hemorrhage in a 94-year-old man: a case report" pptx
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Graves’ disease presenting as pseudotumor cerebri: a case report." docx
... Portugal.
Authors’ contributions
EC analyzed and interpreted the data regarding the neurological
presentation of the disease, and was the major contributor in writing the
manuscript. AMS analyzed and ... interpreted the data regarding the
endocrinological aspects of the case. CF analyzed the endocrinological data
and is responsible for the follow-up of our patient...
Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt
... la
Polyarthrite.
References
1. Asahara H, Fujisawa K, Kobata T, Hasunuma T, Maeda T,
Asanuma M, Ogawa N, Inoue H, Sumida T, Nishioka K: Direct evi-
dence of high DNA binding activity of transcription factor AP-1
in rheumatoid ... nuclear staining with Hoechst H33258. Using image analysis software, the mean green
intensity of the nuclear staining was quantified in 10 randomly s...
Báo cáo y học: "Most nuclear systemic autoantigens are extremely disordered proteins: implications for the etiology of systemic autoimmunity" pps
... of the analy-
sis, interpretation, and writing of the manuscript. BRST con-
tributed invaluable informatics and statistical input as well as
suggesting key aspects of the scaffolding model.
Additional ... recently has come an appreciation that
large regions of some proteins never fold at all, at least in the
absence of a binding partner. Regions that lack a fixed t...
Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx
... models of severe sepsis and systemic
infection. Crit Care 2007, 11:R122.
70. Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka
M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y,
Yamamoto ... proinflammatory mediators called alarmins. As a group,
alarmins display distinct intracellular and extracellular
activities, with potent stimulation of the innate immune syst...
Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot
... replacement the factors that may mainly
favor PVL formation are the annulus calcification and
infections.
We report a case of paraprosthetic l eakage, occurring
seven years after AVR using a continuous ... after 7 years from
the operation and we discuss the role of suture techni-
que in this case of severe paraprosthetic leak without
any clearly infection signs.
Cas...
Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx
... was conducted and analyzed as described
[32]. The primer pair for nppa was F-GGCAACAGAA-
GAGGCATCAGAG and R-GGAGCTGCTGCTTC
CTCTCGGTC. The primer pair for b-actin was F-
CCATTGGCAATGAGAGGTTCAG ... damage, hyperactivation of PARP-1,
which depletes NAD
+
andATPpoolsthatresultsin
increased intracellular cytosolic Ca
2+
concentrations, and
the activation of μ-calpain cysteine protease...
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot
... contributions
TK analyzed and interpreted the patient data and was a major contributor in
writing the manuscript. JR analyzed the patient data and contributed in
writing the manuscript. RP and BE analyzed and ... this coagulopathy, whereas use of aminoca-
proic a cid in states of acquired hemophilia may some-
times be associated with life-threatening complications
in...
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx
... Open Access
Acquired hemophilia as the cause of life-
threatening hemorrhage in a 94-year-old man: a
case report
Theodoros Kelesidis
*
, Jonelle Raphael, Elizabeth Blanchard, Rekha Parameswaran
Abstract
Introduction: ... transfusion.
Hospitalization was also complicated by bradycardia of unclear etiology, which started after infusion of
aminocaproic acid. His activ...
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Benign giant mediastinal schwannoma presenting as cardiac tamponade in a woman: a case report" ppsx
... 5:61
http://www.jmedicalcasereports.com/content/5/1/61
Page 2 of 3
schwannoma presenting as cardiac tamponade in Reck-
linghausen’s disease had a rapidly fatal outcome after
pericardial drainage, whereas in our case, drainage pro-
duced rapid ... et al.: Benign giant mediastinal schwannoma
presenting as cardiac tamponade in a woman: a case report. Journal of
Medical Ca...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật