Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... assay carried out with puriﬁed recombinant plasmid pADC-8; and lanes 5–14 corres-pond to the assay carried out with DNA samples obtained from transformed parasites after 2 days and 2, 4, 6 and ... 633Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruziepimastigotesMarı´ a P. Serra, Carolina Carrillo, Ne´lida S. Gonza´lez and Israel ... N+; Amersham).Total RNA from parasites, before and after transforma-tion, was obtained using TRIzol LS reagent (Invitrogen,Carlsbad, CA, USA) [29]. Samples containing 20 l goftotal RNA were...

Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt

... TCAAAGAAGTCCTGAAGAGCGGGln11 (At5g37600) F: CCTCTCAGACTCCACTGACAAAR: TTCACTGTCTTCACCAGGAGCGln12 (At1g66200) F: TCTCAGACAACAGTGAAAAGATCAR: TGTCTTGACCAGGAGCTTGACGln13 (At3g17820) F: GCCACCGGGAAAATCATCR: ... AATCGAAAACCCTTTCTTAAGLT (At5g53460) F: TTGGACCTGAGCCAACACTTGR: CATCATCCGTTTTGGTGAGGAcarA (At3g27740) F: TGGTCAGGTGGAGATCAGTGCR: GAGGCTTCAGGGTGGTACTGGcarB (At1g29900) F: AGGAAGACCACATGCTGCTGAR: TCAAAGAAGTCCTGAAGAGCGGGln11 ... The amino acids arethen translocated in the apoplasm and in the phloemvia the plasma membrane-located amino acid trans-porters [10]. Glutamine and asparagine, and to a lesserextent arginine,...

Báo cáo khoa học: "Detection of Bartonella species from ticks, mites and small mammals in Korea" pps

... ...

Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt

... think that the results are due to that many shelter cats have been infected with FHV-1 and they remain subclinical carriers after recovery. At least 80% of infected cats remain latently infected ... (5'-TTCGGCCTTTTGTGTTCC-3') and CalcapR (5'-TTGAGAATTGAACACATCAATAGATC-3') amplify a 673-bp conserved region in the capsid protein gene of FCV. Multiplex RT-PCR/PCR was performed according to a previous ... cats in a shelter or a breeding cattery had a low detection rate of C. felis. These results indicate that the Prevalence of FHV-1, FCV and C. felis in an animal shelter 209clinical signs of...

báo cáo khoa học: " Years of life lost to prison: racial and gender gradients in the United States of America" pps

... popula-tion for Caucasian females. In both males and females,there was a consistently clear gradient with rates for His-panics being intermediate between those of African Amer-icans and Caucasians ... (18.4)SOURCE: AJ Beck, JC Karberg. Prison and Jail Inmates at Midyear 2000, 2001, 2002, 2003, 2004.*Includes Indians, Alaska Natives, Asians, Native Hawaiians, and other Pacific Islanders; totals for Caucasian, ... gender and race.Results: African American males can expect to spend on average 3.09 years in prison or jail overtheir lifetime and Hispanic and Caucasian males can spend on average 1.06 and 0.50...

Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx

... Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series. Journal of Medical Case Reports 2011 ... her hip pain improved. About a month prio r to presenta-tion, she again started having hip pain radiating to theanterior region of the right knee. The pain was worsewhen standing up, walking, and ... history of trauma. She was seenby a physician and was diagnosed with osteoarthritis of the hip after an MRI scan. After taking non-steroidalanti-inflammatory drugs (NSAIDs) for a few weeks, herhip...

Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx

... SKTM -A6 3V (5¢-GACAAATACTCTGAAGTACTCAAAGATGCCCAG-3¢), SKTM-1R (5¢-CTGGGCATCTTTGAGTACTTCAGAGTATTGTC-3¢), SKTM-K70T (5¢-AAAGATGCACAGGAGACGCTGGAGCTGGCAGAG-3¢), SKTM-2R (5¢- CTCTGCCAGCTCCAGCGTCTCCTGTGCATCTTT-3¢), ... occur atthe g posi tion of t he repeat. T he K70T mutation alsointroduces changes in the surface charge of Tm. All themutant amino acids are involved in interchain and intra-chain interactions ... the inability of E. coli to N -a cetylaterecombinant Tm. Amino and carboxy terminal ends of Tmare critical for p olymerization and b inding to actin. BecauseTm binds cooperatively in a head-to-tail...

Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

... repeats from human tenascinstudied through a sequence frame-shift approachFrancesco Zanuttin, Corrado Guarnaccia, Alessandro Pintar and Sa´ndor PongorInternational Centre for Genetic Engineering ... structureelements. A qualitative analysis of the spectra suggests theabsence of helical structure, and a dominant component of irregular structure in all the peptides. A quantitative analysis of secondary ... by standard stepwise solid-phase procedure on a 0.1-mmol scale. In f3, an Ala residue was inserted instead of Ile at the N-terminus and an extra Ser residue was added atthe C-terminus to avoid...

Báo cáo khoa học: "Isolation of cholesterol-lowering lactic acid bacteria from human intestine for probiotic use" ppsx

... reductase and acyl CoA: cholesterol acyltransferase (ACAT) havebeneficial effects on hypercholesterolemia and arteriosclerosis[12].Some natural microorganisms in human intestine arebeneficial in ... 235-245.7.Fukushima M, Yamada A, Endo T, Nakano M. Effects of a mixture of organisms, Lactobacillus acidophilus orStreptococcus faecalis on delta6-desaturase activity in thelivers of rats fed a fat- and cholesterol-enriched ... acid- and bile salt-tolerance and be antagonistagainst putrefactive bacteria in GIT [4,9]. In this study,Streptococcus, Lactobacillus and Bifidobacteriumfrom human intestine were selected as...

Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc

... the same areas. Although our data did not elucidate thephysiological role and action mechanism of PACAP in human placenta, the localization of PACAP and its PAC1receptor in the same areas strongly ... determine the existence of PACAP and PAC1 receptor mRNAs in human placenta. Our data showedthe expression of PACAP and PAC1 receptor mRNAs in stroma cells of stem villi and terminal villi. As ... suggest that PACAP mayact as an autoregulator or pararegulator via its PAC1 receptor in stem villi and terminal villi during pregnancy. In conclusion, our findings suggest that PACAP may have animportant...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ