báo cáo khoa học: "Multiple Scedosporium apiospermum abscesses in a woman survivor of a tsunami in northeastern Japan: a case report" potx

... 53:2153-2155.doi:10.1186/1752-1947-5-526Cite this article as: Nakamura et al.: Multiple Scedosporium apiospermum abscesses in a woman survivor of a tsunami in northeastern Japan: a case report. Journal of Medical Case Reports 20115:526.Submit ... 5:526http://www.jmedicalcasereports.com/content/5/1/526Page 4 of 5CAS E REP O R T Open AccessMultiple Scedosporium apiospermum abscesses in a woman survivor of a tsunami in northeastern Japan: a case reportYutaka Nakamura1*, Yu Utsumi1, Naomi ... disseminatedmycotic infections in near-drowning victims. Case presentation: We report the case of a 59-year-old Japanese woman who was a survivor of a tsunami in northeastern Japan and who had...

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-speciﬁc alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... 5¢-TCAAGCCCCGCTACATAGTT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢(Fig. 2A) .Luciferase promoter assayHuman genomic DNA was isolated from two volunteers(both male, Japanese, aged 34 and 37 years) after ... Tsunoda T, Mizushima-Sugano J,Sese J, Hata H, Ota T, Isogai T, Tanaka T, MorishitaS, Okubo K, Sakaki Y, Nakamura Y, Suyama A &Sugano S (2001) Diverse transcriptional initiationrevealed ... K, Yamada T, Tsujioka Y, Taguchi J, Takaha-shi M, Tsuboi Y, Fujino Y, Nakajima M, YamamotoT, Akatsu H, Mitsui S & Yamaguchi N (2000) Localiza-tion of a novel type trypsin-like serine protease,...

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebraﬁsh (Danio rerio) doc

... and Tyr218(Fig. 2). The functional importance of invariant aminoacids of the corresponding alpha-helical C-terminalglobular domain of human PrPCcan be demonstratedwith Pro102, Ala117, and ... prp2hybridization signal in the posterior intestine of zebra-fish larvae call for evaluation of the potential prionsuptake of mammalian origin by the fish intestine.Comparison of zebrafish prp1, prp2, and ... exon 2. A codingsequence of 1821 bp, from a translation initiator ATGcodon at position 86 of the cDNA to a stop codonstarting at position 1905, lay within a single exon of 2018 bp. In mammals,...

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

... associates, within grammar, and as a pragmatic interpretation. Each piece of information is a thresholding device with memory. It has an activity value, initially at a resting state, that is modified ... been associated with certain types of aphasic behavior in English speaking patients, speci- fically in agrammatics and Broca's aphasics. French neurolinguistic studies have documented a ... MEANING-PROPAGATION: Fixed-time spreading activation to the distributed parts of recognized words ' meanings. 6. FIRING-INFORMATION-PROPAGATION: Asynchronous activation propagation that...

Báo cáo khoa học: The chromosomal protein HMGN2 mediates lipopolysaccharide-induced expression of b-defensins in A549 cells potx

... 5¢-GATCCCGTATATGATACCAACAGTAATTC AAGAGATTACTGTTGGTATCATATACGTTTTCA-3¢; antisense, 5¢-AGCTTT GAAAACGTATATGATACCAACAGTAATCTCTTGAATTACTGTTGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-GATCCGACTTCATAAGGCGACTGCT TCAAGACGGCATGCGCCTTATGAAGTCTTTTTTGTCGACA-3¢; ... 5¢-GATCCTCTGCGAGGTTGTCTGCTATTCAAGAGATAGCAGACAACCTCGCAGATCA-3¢; antisense, 5¢-AGCTTGATCTGCGAGGTTGTCTGCTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢;HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGAGATGCCAAAACATTCAAGAGATGTTTTGGCATCTCCATTTTCA-3¢;antisense, ... TCAAGACGGCATGCGCCTTATGAAGTCTTTTTTGTCGACA-3¢; anti-sense, 5¢-AGCTTAGTTCGACAAAAAAGACTTCTTCATAAGGCGCATGCCGTCTTGAAGCACGCCTTATGAAGT-3¢). The complete HMGN2 cDNA was ampliﬁed fromthe total RNA of A5 49...

Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

... Forward: TTCACCACCATGGAGAAGGCReverse: GGCATGGACTGTGGTCATGARTPrimerDB 2920FXR1 Forward: ATAATTGGCAACCAGAACGCCAGGReverse: CCACATGGCTCTTGGTCATTTGCT–TNF -a Forward: CATCTTCTCAAAATTCGAGTGACAAReverse: ... TGGGAGTAGACAAGGTACAACCCRTPrimerDB 147TTP Forward: TGCAATAACCCATTTCCCTGGTGCReverse: TAGGAACGGATCCACCCAAACACT–TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAGReverse: AGGCTGCTTTGATGTCTTCGGTTG–HuA ... blot analysis, usingstandard methodologies with a polyclonal antibody againstFXR1 raised in goats (ab51970; Abcam, Cambridge, UK).An polyclonal antibody against actin, also raised in goats,was...

Báo cáo khoa học: From meiosis to postmeiotic events: Alignment and recognition of homologous chromosomes in meiosis ppt

... even in a mutant lacking Spo11 and other keyfactors for DSB formation and recombination of DNA,some residual levels of pairing still remain, suggestingthat a DSB-independent pairing mechanism ... may also beoperating in this organism [42–44].On the other hand, typical DSB-independent pairingis found in Drosophila and C. elegans. In these organ-isms, initiation of pairing and synapsis ... DSB-independent mechanisms.DSB-dependent pairing has been best investigated in the budding yeast S. cerevisiae, and has also beenfound in animals and plants. In meiosis, DNA DSBs aregenerated...

báo cáo khoa học: "Note Selection for increased and decreased total number of young born in the first three parities in mice" doc

... as a result of selection for litter size have beengenerally moderate or small and only in a few cases a high correlated response wasobtained (JOAKIMSEN & BAKER, ... between laboratoryand farm animals. That practice which is usual in experiments with mice avoids thenegative covariance between litter size of daughter and dam (VANGEN, 1981). ... explains the lower response obtained in generations 9-13 compared to generations 1-8.However results indicated that response for increased TNY-3 although not high wasmaintained...

báo cáo khoa học: " Multi-drug resistance 1 genetic polymorphism and prediction of chemotherapy response in Hodgkin’s " pot

... prediction of chemotherapy response in Hodgkin’s LymphomaNizar M Mhaidat1*, Osama Y Alshogran1, Omar F Khabour2, Karem H Alzoubi1, Ismail I Matalka3,William J Haddadin4, Ibraheem O Mahasneh5and ... containingdoxorubicin (adriamycin), bleomycin, vinblastine anddarcarbazine [3]. While more than 70% of HL patientsare cured after treatment [3], about 30% of them mightexperience relapse after ... non-Hodgkin’slymphoma(NHL).The incidence of HL has risen gradually over the last fewdecades, representing a bimodal incidence peak, in earlyand late adulthood [1].Several modalities are available...

Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

... to as the 'main' equation set. These may be overridden by eontlleting information in a more specific class. Each equation in a main set functions as an independent constraint, in a ... Lexical entries are themselves classes, 4 and any in- formation they contain is standardly specific to an individual word; lexical and non-lexical classes dif- fer in that analysis and generation ... precede any variant sets. The following simplified example illustrates the form and interaction of class definitions. In equs. tions, unification variables have initial capitals, and negation of...

Xem thêm