báo cáo khoa học: " Primary adenocarcinoma of the stomach in von Recklinghausen’s disease with high serum levels of multiple tumor markers: a case report" ppsx

... scattered reports of adenocarcinoma of the GI tractcomplicating peripheral neurofibromatosis [1,3], few caseshave explo red the association of primary infiltrating ade-nocarcinoma of the stomach ... 5:521http://www.jmedicalcasereports.com/content/5/1/521Page 4 of 5CAS E REP O R T Open Access Primary adenocarcinoma of the stomach in von Recklinghausen’s disease with high serum levels of multiple tumor markers: ... report a case of an adenocarcinoma of the stomach in a 53-year-old Japanese man with neurofibromatosis type 1. An abdominal computed tomography scan and ultrasonography showed tumors in hisliver....

báo cáo khoa học: " Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report" docx

... lymphoma as well as positive EBERstaining.Initial treatment ma nagement involved reducing the dose of the patient’s immunosuppressive agents andstarting chemotherapy. Administration of azathioprine,prednisone ... nodular masses in the stomach and duodenum(Figures 6 and 7). A stomach biopsy gave similar resultsas the appe ndix with large anaplastic cells with i rregularnuclei. Immunostaining of the gastric ... presenting unusually as acute appendicitis. Case presentation: A 45-year-old Hispanic male renal transplant patient presented with right-side abdominal pain17 years after transplant. The laboratory...

$Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf$

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

... present in the protein kinase-like domain in the basal state [2].Mutation of any of these sites to alanine led to a decrease in ANP-mediated activation and simultaneous mutations in all the sites ... S.L.,Richardson,K.C.,Fok,K.F.,Currie,M.G.&Forte,L.R.(1994)Distribution of heat-stable enterotoxin/guanylin receptors in the intestinal tract of man and other mammals. J. Anat. 184, 407–417.6. Qian,X.,Prabhakar,S.,Nandi ,A. ,Visweswariah,S.S.&Goy,M.F. ... 10 min at 37 °Cwith4mMMgCl2and 1 mMGTP as substrate.Receptor binding analysisSTY72Fwas iodinated using Na125I as described earlier [30]and was available in the laboratory. Membrane...

Báo cáo y học: "Possible gabapentin and ketamine interaction causing prolonged central nervous system depression during post-operative recovery following cervical laminoplasty: a case report" potx

... remained stable through-out the entire case with mean arterial pressures (MAP)maintained at approximately 100 mmHg according to the surgeon’s request. At the end of the case, althoughbreathing ... forC3-C7 laminotomy. Our patient’s general anestheticconsisted of an initial 100 mg intubating dose of succi-nylcholine followed by total intravenous anesthesia(TIVA) using propofol, ketamine, and ... hemorrhage,thrombosis leading to infarct, hematoma/abscess in the spinal cord, and/or psychological causes. Organic causes, with the exception of prolonged CNS depression from a gabapentin/ketamine drug interaction,...

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA ... 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a 253120 A B18161412**10EGFP intensity86420EGFPEGFP-IL6R...

Báo cáo khoa học: "Primary chondrosarcoma in the skull of a dog" ppt

... ...

Báo cáo khoa học: "First observations on the root morphology and symbioses of 21 major tree species in the primary tropical rain forest of French Guyana" pps

... fre-quent in Venezuela and the Guyanas than in other tropical rain forests, in spite of the factthat the soil fertility is particulary low in theseINTRODUCTION The primary ... tip of the long root. The mostspectacular diversity was found on Voua-capoua americana and on the 2 Eperuaspecies (E falcata and E grandiflora) with shapes ranging from ... sub-family Caesalpinioideae in the Legu-minosae) and to other studies in Africa (eg,Alexander and Högberg, 1986; Fassi and Moser,1991). The Caesalpinioideae sub-family...

báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc

... a case of malignant mixed Müllerian tumor arising in the lower peritoneum of a 72-year-old female patient. The patient presented with ascites, lower abdominal mass and pleural effusion. The serum ... of intrahepatic metastasis. Gall-bladder, stomach, pancreas and appendix wereunremarkable.Histopathology was consistent with the diagnosis of a primary peritoneal malignant mixed M üllerian ... from the tumor reported a carcinosarcoma (see later). The patient underw ent exploratory laparotomy. A widely spread peritoneal carcinosis and a tumor measur-ing20×15×10cminthevesicouterineandDuglas’pouch...

báo cáo khoa học: "Primary atypical carcinoid of the breast: A case report and brief overview of evidence" ppt

... standardized treatment regardingcarcinoid tumors of the breast. In most cases carcinoidtumors are approached as infiltrative carcinomas of the breast. Additionall y, the reported follow-up intervals ... treated in terms similar to primar y breastcancer. No report has been made so far, regarding eitheradjuvant chemotherapy or somatostatin analogues in primary breast carcinoid tumors.To date there ... ensured the diagnosis of a primary atypicalcarcinoid of the breast, the findings were discussed in the breast cancer multidisciplinary team (MDT) meeting in the view of deciding management options....

báo cáo khoa học: "Primary testicular necrotizing vasculitis clinically presented as neoplasm of the testicle: a case report" ppt

... Wedescribe a case with an unusual presentation simulating a testicular neoplasm. Case presentation A 25-year-old Caucasian m an went to a general practi-tioner because of right testicular swelling and ... physical examination, the right testicle wasenlarged and painful on palpation, and the skin of the right hemiscrotal region was red and warm. Painincreased gradually and worsened slightly with time, ... Hematoxylin eosin (HE) staining showing the medium-sized artery in the testicular parenchyma showing fibrinoid necrosisand segmental involvement of moderate inflammatory cell infiltrate and...

Xem thêm