báo cáo khoa học: " A rare occurrence of a steroid cell tumor of the pelvic mesentery: a case report" pot
báo cáo khoa học: " Urethral metastasis from non-seminomatous germ cell tumor: a case report" pptx
... tomography scan and magnetic resonance imaging of the pelvis showed pulmonary, pelvic nodal, ischial and penile metastasis. The diagnosis of the International Germ Cell Cancer Collaborative Group of poor ... present a case of nonseminomatous germ cell tumor of the testes with acute urinary retentionsecondary to urethral metastasis. This presentation, and similar cases of urethral metastasis from this tumor, ... CAS E REP O R T Open AccessUrethral metastasis from non-seminomatousgerm cell tumor: a case reportVijay Agarwal1*, Tze Wah2, Sameer Chilka3, Johnathan Joffe1, Dan Stark1AbstractIntroduction:...
- 4
- 350
- 0
Báo cáo khoa học: Oxidative stress and apoptotic events during thermal stress in the symbiotic sea anemone, Anemonia viridis potx
... two potentialcleavage sites at aspartate residues 164 and 172 forcleaving the prodomain, and a potential cleavage siteat Asp306 for the cleavage between the large andsmall subunits. The prodomain ... rerioAAH78310, Salmo salar AAY28972, Xenopus laevisP55866) and invertebrates (Hydra vulgaris AAF98012,Aiptasia pallida DQ218058, Drosophila melanogasterAAD54071, Caenorhabditis elegans P42573), ... onmammalian cells, we can conclude that there are atleast two original caspase-like activities in the animaltissue of A. viridis.Previous work has already highlighted the presence of a caspase-like...
- 13
- 415
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... organizationRoles of the Las17p (yeast WASP)-binding domain and a novelC-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. ... and growth atelevated temperature, on the one hand, and in corticalactin-patch polarization, on the other hand, are at leastpartially distinct [23]. However, there may still be a functional ... importance of WASP–WIP interaction in mammalian cells is sup-ported by the observation that the vast majority of the disease-causing missense mutations in human WASPmap to the N-terminal WH1...
- 23
- 679
- 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene ... sequencer(Applied Biosystems, Foster City, CA, USA).Expression and purification of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... (Takara Bio Inc.,Shiga, Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-ments containing a...
- 8
- 484
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... FEBSStaphylococcus aureus elongation factor G – structure andanalysis of a target for fusidic acidYang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria SelmerDepartment of Cell and Molecular ... conformational changes in the eukaryotic ribosomal translocase. Nat Struct Biol10,379–385.30 Al Karadaghi S, Aevarsson A, Garber M, Zheltonos-ova J & Liljas A (1996) The structure of elongationfactor ... linker has flipped away tocreate the 40 A ˚shift of domain IV relative todomain IIIMutation to a larger side chain may change the relative positions of domain III and V [16] as well as the position...
- 15
- 474
- 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- andaB-crystallins with early and late unfolding intermedi-ates of citrate...
- 15
- 515
- 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... resinae glucoamylase; Humgr GAM, Humicola grisea glucoamylase.Fig. 1. Stereo view of a CGTase as an example of a five-domain member of the a- amylase family having the C-terminal SBD.638 Sˇ. Janecˇek ... (principally CGTases)was not readily defined, because maltogenic a- amylase,acarviose transferase, and the archaeal CGTase clusteredtogether at a distance from the main CGTase cluster.Moreover the ... transglycosidases and isomerases [1]. All of thesecontain a catalytic (b /a) 8-barrel domain first recognizedin Taka-amylase A, an a- amylase from Aspergillus oryzae[2]. This fold was confirmed by crystallography...
- 11
- 615
- 0
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf
... Agilent microarray scanner.Data analysisRaw intensities of spots were extracted from images byimagene v9.0 software, and the spots with a low signal-to-noise ratio (< 2) were automatically denoted ... isolated using the Trizol reagent(Invitrogen) and purified with an RNAeasy column (Qia-gen). RNA quality was assessed with a 2100 Bioanalyzer(Agilent Technologies, Santa Clara, CA, USA). HomemadecDNA ... Hospital, Shanghai Jiaotong University School of Medicine, China3 School of Pharmacy, Fudan University, Shanghai, China4 MOST-Shanghai Key Laboratory of Disease and Health Related Genomics, ChinaGinkgo...
- 9
- 506
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... the degradation activity of P. hilaris cellulase against crystallinecellulose, Avicel (Merck) was used under the same condi-tions as the CMCase assay. Optimal pH for P. hilariscellulase activity against ... conditions[4,18,19]. The optimal pH for the purified cellulase from the larval gut of P. hilaris against CMC was also 5.5. This isreasonable for the physiological function of cellulase activityin larval guts as ... glucose, because thereare few other potential mechanisms for eliminating it.ThemolecularmassofP. hilaris cellulase deduced fromits DNA sequence is 36.0 kDa. The apparent molecularmass of the purified...
- 6
- 361
- 0
Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc
... CCACATGGCTCTTGGTCATTTGCT–TNF -a Forward: CATCTTCTCAAAATTCGAGTGACAAReverse: TGGGAGTAGACAAGGTACAACCCRTPrimerDB 147TTP Forward: TGCAATAACCCATTTCCCTGGTGCReverse: TAGGAACGGATCCACCCAAACACT–TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAGReverse: ... used: siRNA 1, 5¢-GGGCCC UAA UUA CAC CUC CGG UUA U-3¢; siRNA 2,5¢-GCA AUC CAU ACA GCU UAC UUG AUA A- 3¢;andsiRNA 3, 5¢-GAA GUU GAU GCU UAU GUC CAGAAA U-3¢.Statistical analysisResults are expressed ... used.Name Sequence (5¢–3¢) RT databaseGAPDH Forward: TTCACCACCATGGAGAAGGCReverse: GGCATGGACTGTGGTCATGARTPrimerDB 2920FXR1 Forward: ATAATTGGCAACCAGAACGCCAGGReverse: CCACATGGCTCTTGGTCATTTGCT–TNF-a...
- 12
- 358
- 0
Từ khóa: Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM