báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report" pptx

... this article as: Kenchaiah and Hyer: Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report.Journal ... 5:498http://www.jmedicalcasereports.com/content/5/1/498Page 3 of 4 CASE REP O R T Open Access Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case reportManohara ... function after successful treatment of the lymphoma. Case presentation: A 65-year-old Caucasian woman with lethargy, loss of appetite and peripheral edema wasfound to have anterior hypopituitarism. ...

báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx

... colon.Treatment generally inc ludes surgery, radiation, ther-apy, and chemotherapy. In the treatment of high-gradeintestinal T cell non- Hodgkin’ s lymphoma or anaplastic large cell type lymphoma, a ... factors include advanced age, late stagedisease, and a poor performance status, as well as delay and contraindication of chemotherapy. The prognosis ofsynchronous primary lymphoma in the small ... infiltrate of T cells separating fibers ofthe muscularis propria. Hematoxylin and eosin stain, magnification100 ×.Figure 5 Transmural necrotic tract through the intestinal wall and lymphoma. Fecal...

Báo cáo khoa học: " Acupuncture treatment for idiopathic Horner''''s syndrome in a dog" doc

... enophthalmos, and prolapsed nictitans for 2 days following sudden onset. According to history taking, ophthalmic, neurological, and radiological examination, the patient was diagnosed with idiopathic ... was alert during the examination. Other signs were not found after neurological and otoscopic examination, and complete blood counts, serum protein, and urine analysis were normal. The radiological ... syndrome, and was treated twice by ST-4 and GB-1 acupoint manual stimulation, with dramatic results. Although this method has only been used on one case, this case may indicate the use of needle-AP...

Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

... advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the parser must find, and (since the head daughter ... descriptions includes Bach's (1979) wrapping operations, Pollard's (1984) head-wrapping operations, and Moortgat's (1996) extraction and infixation operations in (categorial) type-logical ... rule are parsed recursively in a bidirec- tional fashion, with the result being a slightly larger head-corner. lln fact, a head-corner parser for a grammar in which the head daughter in each...

báo cáo khoa học: " Urethral metastasis from non-seminomatous germ cell tumor: a case report" pptx

... liver and renal biochemistry was normal. A urethral catheter was placed, and drained normalurine. He underwent a radical left inguinal orchidectomyfive days later. Histology indicated a non- seminomatousgerm ... lie in thelymphatic drainage pathway of the testis. Case presentation A 35-year-old Caucasian man presented to his local gen-eral hospital emergency department with a history ofacute urinary ... CAS E REP O R T Open AccessUrethral metastasis from non- seminomatousgerm cell tumor: a case reportVijay Agarwal1*, Tze Wah2, Sameer Chilka3, Johnathan Joffe1, Dan Stark1AbstractIntroduction:...

Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx

... citation purposes)Journal of Medical Case ReportsOpen Access Case report Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case ... lung carcinomas was6.7%. Only 3 of these 1090 cases were associated with DIPNECH and the primary tumors were carcinoids in allof these cases [4]. We have recently reported a similar case in which ... pulmonarycarcinoid tumors. Case presentation: Here we report on a 60-year-old female patient with DIPNECH and anassociated pulmonary adenocarcinoma.Conclusion: This case contributes to a better...

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... 5¢TCTTCGAGTGCAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar-boxylase mRNA levels, detected by RT-PCR with speciﬁcprimers 5¢GTCAGCCGCATCTTCTTTTG and ... Reck-Peterson SL & Crabtree GR (2002)Nuclear actin and actin-related proteins in chromatinremodeling. Annu Rev Biochem 71, 755–781.3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006)Chromatin remodelling ... shown).However, taken together, these data support the ideathat Rac and Unkempt can translocate in the nuclearcompartment and activate BAF60b ubiquitination;how these processes are co-ordinated remains...

Báo cáo khoa học: The role of the Fe-S cluster in the sensory domain of nitrogenase transcriptional activator VnfA from Azotobacter vinelandii potx

... (underlined): 5¢ -CAAAAGGTCTCGAATGTCCAGCCTCCCCCAATA-3¢ and 5¢-CAAAAGGTCTCAGCGCTGCGGTAGTCCTTGTAGTTGA-3¢. After digestion with BsaI, the PCR product was ligatedinto the BsaI site of pASK-IBA3plus. ... weredetermined using the BCA method (Bicinchoninic Acid Pro-tein Assay Kit, Sigma, Saint Louis, MO, USA) with BSA as a quantitative standard. After the ﬁnal puriﬁcation step,VnfA was transferred ... reside in the GAFdomain and the environmental factors affecting AnfAactivity remain unknown because of the absence of theN-terminal domain in this variant. Because sensing is a principal function...

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

... as the standard and 12.5% TCA as a blank. The exactconcentration was determined at room temperature by mea-suring A 405 and calculated as A 405⁄ e (e – 505 · 103LÆcm)1Æmol)1). A standard ... GST tag and 42 kDa after GST cleavage). The p.Ala226ProfsX28 mutantprotein was approximately 53 kDa before cleavage and strongly degraded after thrombin digest.HMBS enzymatic activity was measured ... clinical symp-toms, leading to misdiagnosis. Additionally, patients with acute attack symptoms and asymptomatic carriersor asymptomatic carriers and healthy individuals canhave similar measured...

Báo cáo khoa học: N-Glycans of the porcine nematode parasite Ascaris suum are modiﬁed with phosphorylcholine and core fucose residues pot

... GalNAcb1–4GlcNAcb1–2Mana1–6(GalNAcb1–4GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; GalGal, Galb1–4GlcNAcb1–2Mana1–6(Galb1–4GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; GnGn, GlcNAcb1–2Mana1–6(GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; MM, Mana1–6(Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; ... PC-containing N-glycans in theC. elegans mannosidase II mutant [22]. Some PC-con-taining glycans also appeared to contain a terminalgalactose residue; however, this is a feature of the para-site ... cycle and infects a large proportion of the world’s population;associated health problems include lung hemorrhage and in ammation, pneumonia, intestinal blockage and immunoglobulin (Ig)E-induced...

Xem thêm