0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

báo cáo khoa học:

báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

... et al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... already reported a case of four malignancies in the same patient including a c ervical carcinoma and a basal cell carcinoma but in a metachronous setting [6].Human papilloma virus (HPV) infection ... involved in the analysis of the data and the literature research, and he also wrote the manus cript. SB helped with the patient management and revision of the manuscript. TM helped with the literature...
  • 4
  • 310
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Major surgery in an osteosarcoma patient refusing blood transfusion: case report" pps

... contributionsAD was involved in writing and editing the final manuscript. VAS was the Orthopaedic Oncologist who treated and planned the management of the patient and was involved in critical appraisal of ... blood transfusion: case report Amreeta Dhanoa1*, Vivek A Singh2, Rukmanikanthan Shanmugam2, Raja Rajendram3AbstractWe describe an unusual case of osteosarcoma in a Jehovah’s Witness patient ... was used. A 20 gauge intravenouscannulainthedorsumoftherighthandwasusedtoinduc e anae sthesia. After induction, an 18 gauge cannulawas inserted in the right external jugular vein. The Tren-delenburg...
  • 6
  • 281
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx

... transgenic plants via Agrobacterium-mediated transformation in the Liliaceous ornamentals was affected by several factors such as, target material for Agrobacterium inoculation, kind of Agrobacterium ... transgene copy number and the activity of transgene expression in the transformed materials. In the future, the methodology for lily transformation from other cultivars and different Agrobacterium ... containing the nptII gene for kanamycin resistance driven by a nos promoter and GUS gene coding for ß-glucuronidase and the bar gene, coding for phosphinothricin acetyltransferaza. Cefotaxime...
  • 6
  • 343
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... within the fusion proteins, wecalculated the theoretical average spectra of equimolarIDP and GFP mixtures by averaging the spectra of the individual IDP and GFP proteins. Note that eachaverage ... (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotideposition –6 and a reverse primer (5 ¢ -A TCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCGCCATGCTCTTGATCCC-3¢) ... molecular masses of both NTAIL-GFP and PNT-GFP were higher than calculated from their amino acid sequence ($96 kDa instead of 43 kDa and $73 kDa instead of 53 kDa, respectively). The extent of the...
  • 14
  • 672
  • 0
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... activates adenylatecyclase (CyaA) and leads to an increase in the intra-cellular cyclic AMP (cAMP) level [1].Mathematical models of cataboliterepression in E. coli The (isolated) reactions of the ... intra-cellular metabolites. An approach that combines fluxbalance analysis (FBA) with an ordinary differentialequation (o.d.e.) model of the slow time scales is calleddynamic flux balance analysis (dFBA), ... culturesallow the determination and analysis of the dynamics in different time windows. The analysis of the mutantstrains clearly showed that a large experimental effortis necessary for the rational design...
  • 9
  • 723
  • 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... universal cell- signalling cascades including MAPK and phosphatidylinositol3-kinase (PI3K) pathways that can target HtrA2, PINK1, Parkin and DJ-1. Likely these PD-associated proteins are part of a complexnetwork ... kinases including casein kinase 1, protein kinase A, proteinkinase C [86] and cyclin-dependant kinase 5 [87]. Phos-phorylation of Parkin by CDK5 may regulate its ubiqu-itin-ligase activity and therefore ... and ATP1 3A2 cause autosomal-dominant forms of parkinsonism.Mutations in the genes encoding Parkin, DJ-1 and PINK1 all cause autosomal-recessive parkinsonism of early onset and are the focus of...
  • 9
  • 775
  • 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... organizationRoles of the Las17p (yeast WASP)-binding domain and a novelC-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. ... polyclonal GFP-spe-cific antiserum was a gift from J. Kahana and P. Silver(Dana Farber Cancer Center, Boston, MA). The anti-actinmAb was MAB1501 from Chemicon International (Teme-cula, CA). The anti-hexokinase ... suggesting that the physiological role of this interaction is conserved [30,52]. Interactions of Vrp1p and Las17p in yeast and WIP and WASP-fam-ily proteins in mammalian cells are direct and resultin...
  • 23
  • 679
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Identifying Sarcasm in Twitter: A Closer Look" docx

... comparisons of i) Sarcastic and Non-Sarcastic (S-NS); ii) Sarcastic and Positive (S-P) and Sarcastic and Negative (S-N). The NS tweets were obtained by merging 450 randomly selected positive and 450 ... Analysis and Opinion Mining, in 'Proceedings of the Seventh conference on Interna-tional Language Resources and Evaluation (LREC'10)' , European Language Resources Associ-ation ... of wordnet. In Proceedings of the 4th International Conference on Language Re-sources and Evaluation, Lisbon. Tepperman, J., Traum, D., and Narayanan, S. 2006. Yeah right: Sarcasm recognition...
  • 6
  • 444
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

... in a single comparison. Thus, using the full comple-ment of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns“as ADJ and * as” and “as * and ADJ as” ... largerbody of resonant combinations than the averagehuman. The necessary barrage of linguistic stimulican be provided by the Google 1T database of Webngrams (Brants and Franz, 2006). Trawling thesengrams, ... A as P” is a meaningful and memorable comparison? The property A can be simple, as in “as dark as a chocolate espresso”, or complex, as in “as dark and sophisticated as a chocolate martini”. In...
  • 6
  • 442
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Event Extraction in a Plot Advice Agent" doc

... remarkable at firstglance. However, recall that the human raters had an average of 56% agreement on story ratings, and in that light the Naive Bayes learner approaches the performance of human ... via automatic event extraction can beused in both natural language understanding and advice generation in the domain of narrative in- struction. The background application is a fullyautomated ... teachers are interested in a plot anal-ysis agent that can give online natural languageadvice and many students enjoy feedback from an automated agent (Robertson and Cross, 2003). Weuse automatic...
  • 8
  • 420
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP