báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx
báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx
... active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation statusAyad M Al-Katib*, Yuan Sun, Anton Scott Goustin, Asfar Sohail Azmi, Ben Chen, Amro Aboukameel ... T/CCleavage of caspase 9, 3 and PARP protein and induction of Caspase 3, 9 activity and resulting DNA fragmentation in TW-37 treated lymphoid cell linesFigure 3Cleavage of caspase 9, 3 and PARP ... of each Bcl-2 family protein wasdetermined by scanning band density using "AlphaE-aseFC" software and normalized to density of the β-actinband of same sample and the quantification...
- 13
- 236
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... discuss the consequences of variation and bias inrelation to monitoring of animal disease incidence onherd and national level, causal analysis on national level,as well as estimation of validated ... veterinarian's perception of the specific farm and by his or her evaluation of the localcontext. That is, treatment data as an indicator of a certaindisease manifestation may only be valid ... phenomena; 'scoring and recording data on metritis' that relate to the quality of thedata that are produced. We analyse and build &apos ;a model of understanding' based on DBL's...
- 10
- 587
- 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
... members of theBrassicaceae. Recently, we were able to detect lipid-bound cyclic oxylipins in Arabidopsis arenosa, Arabid-opsis halleri, Arabidopsis petraea, Arabidopsis thaliana,Arabis pendula, ... Yang W, Devaiah SP, Pan X, Isaac G, Welti R &Wang X (2007) AtPLAI is an acyl hydrolase involvedin basal jasmonic acid production and Arabidopsisresistance to Botrytis cinerea. J Biol Chem ... Rev PlantBiol 60, 183–205.87 Shibata T, Yamada T, Ishii T, Kumazawa S,Nakamura H, Masutani H, Yodoi J & Uchida K(2003) Thioredoxin as a molecular target of cyclopente-none prostaglandins....
- 12
- 416
- 0
Báo cáo khoa học: The equinatoxin N-terminus is transferred across planar lipid membranes and helps to stabilize the transmembrane pore pot
... transferred across planarlipid membranes and helps to stabilize the transmembraneporeKatarina Kristan1, Gabriella Viero2, Peter Mac˘ek1, Mauro Dalla Serra2 and Gregor Anderluh11 Department ... ME & Lissi EA (2003) Comparison of pore-forming ability in membranes of a native and a recombinant variant of sticholysin II from Stichodactylahelianthus. Toxicon 42, 571–578.36 Iacovache ... Cloning and characterization of an acidic cytolysin cDNA from seaanemone Sagartia rosea. Toxicon 40, 1563–1569.47 Klyshko EV, Issaeva MP, Monastyrnaya MM, Il’ynaAP, Guzev KV, Vakorina TI, Dmitrenok...
- 12
- 375
- 0
Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt
... sentences and markables- part of speech of the head of the markables- the grammatical functions- parallelism of grammatical functions- do the heads match or not- where is the pronoun (if any): ... (pronominal anaphora) and (Versley, 2006) (nominal anaphora).Common to all ILP approaches (incl. ours) is that they apply ILP on the output of pairwisemachine-learning. Denis and Baldridge ... POS is pronoun- salience of the non-pronominal phrases- semantic class of noun phrase headsTable 1: Features for Pairwise ClassificationAs a gold standard the T¨uBa-D/Z (Telljohannet al.,...
- 9
- 436
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... exchange columns (Amersham Bio-sciences ⁄ GE Healthcare, Piscataway, NJ, USA), superfineG-25 Sephadex (Pharmacia ⁄ Pfizer, Oakville, ON, Canada) and a stirred ultrafiltration cell (Amicon Bioseparations ... spectra were acquired on a Cary 5G UV-Vis-NIRspectrophotometer (Varian Canada Inc., Mississauga, ON,Canada) in a 1 cm quartz cuvette at room temperature(22 °C) and recorded using the cary win ... v.7.0383.MSMass spectra were acquired on an ESI-TOF mass spectro-meter (Waters Micromass Inc., Mississauga, ON, Canada)at room temperature (22 °C), and recorded using the masslynx v.4.0 software package....
- 9
- 533
- 0
Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx
... conserved core of modificationsobserved in tRNAs of almost all organisms [44] archaea,bacteria and eukarya each make phylogenetically character-istic modifications to their tRNAs following transcription,which ... in animalmitochondria. While bacteria and organelles contain threeisoacceptor families comprising long variable arms (type 2tRNAs; tRNASer,tRNALeu and tRNATyr), eukaryoticcytoplasm and ... Serylation of homologous and heterologous tRNAsSer and tRNAsSecby SerRSs from methanogenic archaea. (A) Serylation wasperformed at 37 °C and the charging plateau with M. maripaludis(filled bars)...
- 9
- 341
- 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... inverted terminal repeat amplification were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATTTable 1. Primers and probe sets ... CGCTTTCGGAGGTGCTTTCGCAGM1941p65.R: TCAGAGTTCCCTACCGAAGCAGP0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGAM225PO.P: CCGTGGTGCTGATGGGCAAGAAM267PO.R: ACCATGATGCGCAAGGCCATp21WAF1/CIP1Cyclin-dependent ... A & KandarianSC (2003) Global analysis of gene expression patternsduring disuse atrophy in rat skeletal muscle. J Physiol551, 33–48.12 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y,Tanaka...
- 16
- 428
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... specific mRNAs. This is well illustrated by the increased translation of the acti-vating transcription factor 4 (ATF4), a transcriptionfactor that initiates a transcriptional program increas-ing ... stronglyimpair the phosphorylation of eIF2aSer51, attenuation of translation and polysomal dissociation that nor-mally occur in response to pharmacological induction of ER stress leading to PERK activation ... 2007)doi:10.1111/j.1742-4658.2007.06110.xPhosphorylation of the a- subunit of the eukaryotic initiation factor 2(eIF2) on Ser51 is an early event associated with the down-regulation of protein synthesis at the level of translation and initiation...
- 11
- 376
- 0
Báo cáo khoa học: Lipins from plants are phosphatidate phosphatases that restore lipid synthesis in apah1Dmutant strain of Saccharomyces cerevisiae ppt
... SGDVDGTGDVDGT A AG A DVDGT SGAAAAFig. 1. PAH1 homologs from plants have similar domain organiza-tion to yeast PAH1 (ScPAH1) polypeptide. Arabidopsis PAH1 (At-PAH1), Arabidopsis PAH2 (AtPAH2) and B. napus ... 5¢-ATGTATCTTGATAATTCTGCTGAAGCATATTTCATCAGG-3¢ and R4:5¢-CCTGATGAAATATGCTTCAGCAGAATTATCAAGATACAT-3¢); D70 7A (F5: 5¢- ACCAAGATAGTGATTT012345678Leaves Flowers Buds Roots Stems SiliquesRelative expressionAtPAH1 AtPAH2Fig. ... con-structed mutant AtPAH1 alleles (G8 3A, D70 7A, D70 9A and S75 2A) and mutant BnPAH 1A alleles(G8 3A, D61 6A and D61 8A) and expressed them in thepah1D strain. Yeast cells were harvested after 16 h of induction...
- 12
- 406
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ