Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx
Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx
... [2,11,19] evaluated the association of a largenumber of dynamic plantar loading variables with Achilles tendinopathy. Findings showed those with Achilles tendi-nopathy demonstrated a significantly more ... biomechanics during running in individuals with achilles tendinopathy: a systematic review. Journal of Foot and Ankle Research 2011 4:15.Submit your next manuscript to BioMed Centraland take full advantage ... biomechanics during running in individuals with achilles tendinopathy: a systematic reviewMunteanu and BartonMunteanu and Barton Journal of Foot and Ankle Research 2011, 4:15http://www.jfootankleres.com/content/4/1/15...
- 17
- 352
- 0
Báo cáo y học: "Different ways to repair the mitral valve with artificial chordae: a systematic review" potx
... Masuda M, Yasutsune T, Nishimura Y: Surgical application for prolapsed anterior mitral leaflet. Surg Today 2005, 35:812-818.12. Minami K, Kado H, Sai S, Tatewaki H, Shiokawa Y, Nakashima A, ... Cardiovascular Surgery 1997, 5(1):125-128.3. Murakami T, Yagihara T, Yamamoto F, Uemura H, Yamashita K, Ishizaka T: Artificial Chordae for mitral valve reconstruction in Children. Ann Thorac ... Heart and Great Vessels Department, University of Rome "Sapienza", Latina, ItalyReferences1. Morita S, Yasui H, Harasawa Y, Tomita Y, Tominaga R: Extensive use of artificial Chordae...
- 6
- 325
- 0
Báo cáo y học: " Prolonged venous bleeding due to traditional treatment with leech bite: a case report" potx
... may be associated with morbidity such as serious bleeding and skin infec-tion. Anemia can of ten be seen with leech infestation.Erysipelas and skin abscess with Mycobacterium mari-num may also ... Her medical historywas otherwise unremarkable. There was no bleeding dia-thesis and she was not taking any medication. On physi-cal examinatio n, she was a healthy woman with nofindings of ... to as hirudothera-phy in modern medicine. Today, medicinal leech ther-apy is mainly used in plastic surgery and reconstructivesurgery for tissue flap salvage [1]. Medicinal leech ther-apyinTurkeyisatraditional...
- 3
- 449
- 0
Báo cáo y học: " Effectiveness of psychotherapeutic, pharmacological, and combined treatments for chronic depression: a systematic review (METACHRON)" ppsx
... CochraneCollaboration; 2009.34. Furukawa TA, Cipriani A, Barbui C, Brambilla P, Watanabe N: Imputingresponse rates from means and standard deviations in meta-analyses.Int Clin Psychopharmacol ... Sengupta ASB, J E, Williams JW, et al: Treatment of dysthymiaand minor depression in primary care: a randomized trial in patientsaged 18 to 59 years. J Fam Pract 2001, 50:405-412.11. Ravindran AV, ... substantially. LH participated in formulating the researchquestion, in the design and coordination of the study, as well as in draftingthe manuscript. All authors read and approved the final manuscript.Competing...
- 6
- 304
- 0
Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: When are antibiotics indicated? A systematic review" ppsx
... SwitzerlandEmail: Milo A Puhan* - milo.puhan@usz.ch; Daniela Vollenweider - danivollenweider@yahoo.de; Tsogyal Latshang - Tsogyal.Latshang@usz.ch; Johann Steurer - johann.steurer@usz.ch; Claudia ... pulmonary disease:when are antibiotics indicated? A systematic review. Respira-tory research 2007, 8:30.2. Anthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK,Nelson NA: Antibiotic ... CentralPage 1 of 3(page number not for citation purposes)Respiratory ResearchOpen AccessCorrectionExacerbations of chronic obstructive pulmonary disease: When are antibiotics indicated? A systematic...
- 3
- 240
- 0
Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: when are antibiotics indicated? A systematic review" doc
... bronchiectasis.We included trials evaluating any antibiotics that wereadministered orally or parenterally daily for a minimumperiod of at least three days. We chose three days becausethis is the minimum ... whether a watchful-waiting strategy is clinically notdisadvantageous but associated with reduced use of anti-biotics.Factors other than treatment setting that may guide anti-biotic treatment also ... intensive care unit, health-related quality of life,symptoms, mortality, and any adverse events registered during the study period.Search strategyThe search was carried out by information specialists(Bazian,...
- 11
- 506
- 0
báo cáo hóa học:" Heath-related quality of life in Spanish breast cancer patients: a systematic review" pptx
... J,Sanchez-Perez MJ, Chirlaque MD, Larranaga N, Martinez-Cobo R,Tobalina MC, Vidal E, Marcos-Gragera R, Mateos A, Garau I, Rojas-Martin MD,Jimenez R, Torrella-Ramos A, Perucha J, Perez-de Rada ... Cancer” alsobeing used as a key word; “Quality of life” AND “Breastcancer” in Dialnet; “quality” AND “life” AND “cancer”AND “breast” in IBECS; “quality of life” and “breast can-cer ” and “Spain” ... Farrus B, Casas F, Verger E,Biete A, Craven-Bartle J, Sierra J, Arcusa A: A randomized trial of the effectof training in relaxation and guided imagery techniques in improvingpsychological and...
- 10
- 479
- 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps
... Sense: ACAGATGATGACACTGCCACCAntisense: CATAGTAGAGATATGGAGTGCTGC55 324 35Internal controlEF1α Sense: AGGTGATTATCCTGAACCATCCAntisense: AAAGGTGGATAGTCTGAGAAGC54 234 25rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTCAntisense: GTCCATAAACCACACTATCACCTCG51 483 35ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCAAntisense: ATCTCGTTGTCTGAGTACCAGTCC51 454IHH Sense: GAGGAGTCCCTGCATTATGAAntisense: CAGGAAAATGAGCACATCGC54 321 ... wasadministered as shown by staining with alcian blue, COL II andCS4 and the quantitative GAG assay, indicating increasedGAG levels at days 14 and 21 in the BMP-2-modified aggre-gates. Notably, chondrogenic...
- 15
- 830
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... disease1 Injuries/diseases without any need for acute physician care2 Injuries/diseases requiring examination and therapy by a physician but hospital admission is not indicated3 Injuries/diseases without ... were admittedto Stavanger University Hospital. We defined severetrauma as a primary diagnosis of traumatic injury and a National Committee on Aeronautics severity of injury orillness index (NACA) ... seriously injured patients treated in a typical [7,8] Norwegian HEMS. We focused onwhether trauma patients with an indication for pre-hospital ETI actually received it (quality of airway man-agement)...
- 6
- 611
- 0
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Australian and New Zealand Intensive Care Society; ANZICS-APD = Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and ... hospitals that had not intro-duced an MET service using the first year of data as baselineand the second year as comparator. Finally, an additional andsimilar analysis was performed for hospitals ... Resources(ARCCCR) maintains a database recording information oncritical care resources, including the timing of introduction ofMETs. In addition, ANZICS maintains an Adult Patient Data-base (ANZICS-APD),...
- 8
- 639
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ