Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx
... diagnosis and management of asthma over the past decade, as wellas the availability of comprehensive and widely-acceptednational and international clinical practice guidelines for thedisease[6,7],asthmacontrolinCanadaremainssuboptimal. ... (ICSs) are the most effectiveanti-inflammatory medications available for the treat-ment of asthma and represent the mainstay of therapy for most patients with the disease. The current Cana-dian ... AAhmet@cheo.on.ca1University of Ottawa, Children’s Hospital of Eastern Ontario, Ottawa, Ontario,CanadaFull list of author information is available at the end of the articleAhmet et al. Allergy, Asthma & Clinical...
- 12
- 774
- 0
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... Party:Clinical Practice Guidelines for the management of melanoma in Australia and New Zealand Wellington: Cancer Council Australia and Australian CancerNetwork, Sydney and New Zealand Guidelines ... spectrum of malignant melanoma of the nail apparatus. Semin Dermatol 1991, 10:82-87.22. Franke W, Neumann NJ, Ruzicka T, Schulte K: Plantar malignant melanoma - a challenge for early recognition. Melanoma ... misdiagnosed as verruca plantaris: a case report. Dermatol Online J 2006, 12.36. Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty acral amelanotic malignant...
- 4
- 403
- 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... TBqÆmmol)1.Binding and cAMP assay For the determination of the binding affinity and the biological potency of the photoactivatable CRF antagonists,HEK 293 cell lines, stably transfected with cDNA coding for rCRF1or ... Germany;2Institute for Molecular Biosciences, The University of Queensland, St Lucia,Australia A novel photoactivatable analog of antisauvagine-30 (aSvg-30), a specific antagonist for corticotropin-releasing ... 2002specific for CRF receptor type 2b. Due to the similarity of the pharmacological profile of mammalian CRF 2a and CRF2b, the new ligand, which we propose to name photoantisauvagine, should serve as a...
- 7
- 344
- 0
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
... the medical chart review. Using Spearman non-parametric tests, the correlations between the RARBIS and various forms of administrative data variables were then analysed. Data takenfrom one year before ... health care utilisation data indicators of RA severityWe extracted the following information from the VA data-bases: rehabilitation visits (physical and occupational therapy),rheumatology ... How-ever, because the VA contains rich data from both medicalrecord and health care utilisation databases, it is a unique and ideal data source for our analysis. Additionally, the RARBIS,which...
- 9
- 274
- 0
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx
... acquisition, analysis and interpretation of the data, and participated in drafting the manuscript. RG partici-pated in the analysis and interpretation of the data. SG con-tributed to the acquisition of ... the conception of the study, and the acqui-sition, analysis and interpretation of the data, and participatedin drafting the manuscript. PSP contributed to the conception of the study, and acquisition, ... 1-specifi-city) of a particular cut-off value, and may help in selecting the optimal cut-off value for a new scale: i.e. assuming an optimalFAS cut-off value of 5.7, sensitivity was 78.8% and specificity74.5%....
- 12
- 423
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-specific primer s Pnf (AGCATTTGGTTTTAAATTATG-GAGTATATG) and Pmr (GTTTTACTTACTCTCGTCTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S,Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K,Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primarymyelofibrosis and ... positivity at a very early stage and should have major implications in diagnosis and prevention of MPNs and other diseases that ma y beaffected by JAK2V617F.MethodsSample collection and DNA extractionDe-identified...
- 7
- 435
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... context, the range of each measure across included footwear was alsoreported. Intra-rater and inter-rater reliability for all cate-gorical data was evaluated using percentage agreement, and kappa ... (greater medialthan lateral wear at the heel and forefoot), which mayindicate excessive pronation, or lateral (greater lateralthan medial wear at the heel and forefoot), which mayindicate excessive ... willeffect the position of the foot in the shoe, forefoot heightwas also measured. This measurement was taken at the level of both the first and fifth metatarsophalangeal joints and the average of both...
- 12
- 379
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... methodsStavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland County,which consist of ... performed at the discretion of the treating physician, and a variety of anaesthetic drugs are available to facilitate ETI. Writtenguidelines for pre-hospital ETI were available in the Sta-vanger ... in many countries. However, limited data are available on the actual quality and safety of anaesthesiologist-managed pre-hospital endotracheal intubation (ETI). To explore whether the generalindications...
- 6
- 611
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... study, and performed the statistical analysis. RA conceived of the study, participated in the design of the study, performed the statistical analysis and Figure 4Eosinophil cell count and C-reactive ... the acquisition of data. NMhelped to draft the manuscript, and participated in the acquisi-tion of data. AZ participated in the coordination of the study.AAZ participated in the design of the ... purposes)Authors' contributionsKA and IK contributed equally to the work. KA and IK drafted the manuscript and participated in the acquisition of data and the study design. JB participated in the...
- 10
- 597
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cellsKentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa1Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The effect of a- tocopheryl hemisuccinate ... electrophoretically to a poly(vinylidenedifluoride) membrane. The membrane was treated with a rabbit anti-iNOS polyclonal antibody or rabbit anti-PKCpolyclonal antibody at 1 : 1000 dilution and anti-(rabbitIgG) ... N-1-naphthyl-ethylenediamine dihydro-chloride) [27]. Nitrite diazotiates the aryl amine, and then the diazotiated product forms an azochromophore bycoupling with naphthyl-ethylenediamine. Absorbance wasmeasured...
- 6
- 494
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ