Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... and read and approved the final manuscript.Additional materialAdditional file 1 Development and evaluation of a tool for the assessment of footwear characteristics compressed folder. The compressed ... CentralPage 1 of 12(page number not for citation purposes)Journal of Foot and Ankle ResearchOpen AccessResearch Development and evaluation of a tool for the assessment of footwear characteristicsChristian ... context, the range of each measure across included footwear was alsoreported. Intra-rater and inter-rater reliability for all cate-gorical data was evaluated using percentage agreement, and kappa...
- 12
- 379
- 0
Báo cáo y học: "omparative and functional genomics provide insights into the pathogenicity of dermatophytic fungi" pps
... annotatedmanually and compared to the automated predictions,indicating a specificity of 82% at a sensitivity of 97%. For the annotation and comparative analyses of the gen-omes a web based genome ... the basic meta-bolic machinery for glycolysis, tricarboxylic acid cycle,glyoxylate cycle, pentose phosphate shunt, and synthesis of all 20 standard a mino acids and the five nucleic acidbases. ... Heitman J: Organization and evolutionarytrajectory of the mating type (MAT) locus in the dermatophyte and dimorphic fungal pathogens. Eukaryotic Cell 2010, 9:46-58.39. Aimanianda V, Bayry J,...
- 16
- 463
- 0
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... already scheduled for coronary angiography for any indication and had no history of a coronary revascularization procedure prior to the scheduled angiography. Forty-four patients had a history ... 260 and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial infarction. Health Technol Assess. 2004; 8: 1-207. 34. Elhendy A, Bax ... Mathematical transformations of ECG data The 3DMP ECG analysis employs six mathematical transformations. All these transformations are based on the power spectrum of the recorded ECG leads...
- 15
- 456
- 0
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... Metcalfe M. Systematic review of the effectiveness and cost-effectiveness, and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial ... Harris RA, et al. The role of coronary angiography and coronary revascularization before noncardiac vascular surgery. JAMA. 1995; 273: 1919-1925. 8. Scanlon PJ, Faxon DP, Audet AM, et al. ACC/AHA ... Beasley JW, et al. ACC/AHA guideline update for the management of patients with unstable angina and non-ST-segment elevation myocardial infarction 2002: summary article: a report of the American...
- 12
- 418
- 0
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Hematology, University of Perugia, Perugia, Italy). The forward and backward primers were: 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGATGGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined ... protein. The purified protein was dialysed against phosphate-buffered saline (PBS) overnight at 4°C and stored at -80°C before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay ... 12. Vardiman JW, Thiele J, Arber DA, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes....
- 6
- 431
- 0
Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx
... standard error (deviation) for the x values (reference method values); SEC: standard error of calibration; SECV: standard error of cross-validation; SEL: standard error for the laboratory data ... enhancingend-product quality. The ability to assess wood quality is a critical challenge facing the forest industry. In intensivelymanaged forests such as clonal eucalyptus plantations where the raw material is ... information. The NIRSsystem is calibrated on the basis of a set of fully characterizedsamples and mathematical models with high prediction accu-racy. The sample set must be representative of the variabilityof...
- 12
- 316
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... value of a large bracketed training corpus is that it allows the grammar- ian to obtain quickly a very large 3 set of sentences that 2Actually there are 18 x 3 = 54 labels, as each label L has ... words and phrases (more pre- cisely, for nominal, adjectival and adverbial words and phrases), the feature, being otherwise otiose, carries the semantic category of the head. The mnemonic names...
- 8
- 562
- 0
báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf
... Main and second activitiesStatus CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SAEvent +CA2 +SA +MA2 + SA2 +CA -SA -MAResult CA1 stop CA → MA MA1 stop SA1 stop MA stop SA stop MA stopCA2 start SA ... SA start MA2 start SA2 start SA stop MA → CA SA stopCA start SA → CACA startCA = Central Activity (no second activity).MA = Main Activity.SA = Second Activity.Journal of Occupational Medicine ... observation are automat-ically saved in a tab-delimited file.When the assessment is complete, data from each case istransferred to a PC and evaluated statistically and graphi-cally: the number of individual...
- 5
- 381
- 0
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... CGTCTCAGTGATCCG-GGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3:5' TAACATCATCATGAGACAGAGC 3' and Ts4:5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier[6].Single-step Dengue ... Furthermore, all the serum samples from a panel of 40 healthy individualsanalyzed in this study revealed no amplification, therebyestablishing the specificity of this assay. Evaluation of Multiplex ... RT-PCR The feasibility of the assay for clinical diagnosis was vali-dated by evaluating with serum samples from 620 acute-phase suspected patients and 40 healthy individuals from the same area....
- 5
- 482
- 0
báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt
... Taylor, Petra Schaefer, David Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance. The study was funded by the Division of Intramural Research ... not for citation purposes)Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, UgandaVariable Total ... Tibenderana H, Meya D, John L, Mandalia S,Nabankema M, Namugga I, Quinn TC, Gazzard B, Reynolds SJ, NelsonM: Evaluation of filter paper transfer of whole-blood and plasma samples for quantifying...
- 10
- 533
- 0
Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenmen s help seeking development and evaluation of the barriers to help seeking scaleprotocols for the development and evaluation of bcg vaccination against m bovis infection in badgersimmunological assays to support the development and evaluation of a vaccine against badger tuberculosisdevelopment and evaluation of male sterile baby corn varietiesdevelopment and evaluation of the non detasseled baby corn variety kasetsart 1development and evaluation of qsars for ecotoxic endpoints the benzene response surface model for toxicitytài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfhuman resources scanning a tool for the implementation of sustainable developmentsurface chemistry as a tool for the development of advanced refractory castablesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ