báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf

... generalnature and intent of the PARIHS framework. • Basic expectations for applying any framework, the- ory, or model were a guiding influence, that is, the need for clear conceptual and operational definitions, ... et al.: A Guide for applying a revised version of the PARIHS framework for implementation. Implementation Science2011 6:99.Submit your next manuscript to BioMed Centraland take full advantage ... questions for diagnostic analysisand planning. All of the separate components of the actual Guide are contained in additional files (seeAdditional Files 1, 2, 3 and 4). The main narrative pro-vides...

Báo cáo khoa học: "Treatment planning using MRI data: an analysis of the dose calculation accuracy for different treatment regions" ppt

... phantomprovided by the vendor for each available CT tube vol-tage. The HU homogeneity was verified us ing a CAT-PHAN 600 phantom (The Phantom Laboratory, Salem,NY, USA), and the peripheral HU value varied ... standard CT geometry. The mean MU values of the bulk density assigned planswere within 1% of the CT plans for all patient groups.There was a consistent improvement of the calculationaccuracy ... calculations and drafted the manuscript. TNconceived the study and participated in its design and helped draft the manuscript. MGK participated in the design of the study and gathered alldata....

Báo cáo khoa học: "Cationized gelatin-HVJ envelope with sodium borocaptate improved the BNCT efficacy for liver tumors in vivo" pptx

... Nakagawa K, Takahashi H, Nakazawa M, Eriguchi M:Evaluation of neutron dosimetry on pancreatic cancer phantom model for application of intraoperative boron neutron-capture therapy. BiomedPharmacother ... (MEXT).Author details1Department of Surgery, Osaka University Graduate School of Medicine,Osaka, Japan.2Medical Center for Translational Research, Osaka UniversityHospital, Osaka, Japan.3Particle ... Kasaoka S, Maruyama K, Kumada H, Sakurai Y, Masunaga S,Ono K, Miyatake S: Tumor-specific targeting of sodium borocaptate (BSH)to malignant glioma by transferrin-PEG liposomes: a modality for...

Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

... cDNAcoding for human p2 5a and primers 5¢-CACTCTAGAC-CATGGCTGCATCCCCTGAGCTCAGT-3¢ and 5¢-CAC-GGATCCCTACTTGCCCCCTTGCAC-3¢ for P25aDN,and 5¢-CACTCTAGACCATGGCTGACAAGG-3¢ and5¢-CACGGATCCCTACGTCACCCCTGA-3¢ ... was ampliﬁedand tagged with six histidine residues by PCR using for- ward primers 5¢-CACCATCACGGAGCATCCCCTGAG-3¢,5¢-TCGCATCACCATCACCATCACGGAGCA-3¢ and5¢-CACCCATGGGATCGCATCACCAT-3¢, and reverseprimer ... vials, and centrifuged for 15 min at 16 000 g and the supernatant was transferred to new vials. A fraction wasretained for determination of total protein. The remainder of the supernatant was...

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

... zinc-bound Ab andsoluble copper-bound GIF [38]. Therefore, the metalswap led to simultaneous modiﬁcation of the ﬁnalform of Ab(1–40) and suggests that it caused the de-aggregation of Ab. In a therapeutic ... the levels of GIF are altered dramatically in the neurode-generative or traumatically injured brain. The best-characterized example of this is for AD. Indeed, manystudies have analysed the amount of ... Kohmura E, Sakaki T, Nonaka M,Yamada K, Yamashita T, Kishiguchi T, Sakaguchi T &Hayakawa T (1997) Expression of growth inhibitoryfactor mRNA after focal ischemia in rat brain. J CerebBlood...

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... immunoreactiveGrb14 was examined using preparative and analyticalfractionation and compared to that of the IR. Upondifferential centrifugation (Fig. 1A) , Grb14 was detect-able as a major protein of 60 kDa in ... Incorporated (Lake Placid, NY,USA). Monoclonal antibody against EEA1 (clone 14) wasfrom BD Transduction Laboratories (San Jose, CA, USA).Monoclonal antibody against Na+⁄ K+-ATPase a- subunit(clone ... with the micro-somal, plasma membrane and Golgi ⁄ endosomefractions was partially extracted by treatment withKCl at concentrations above 1 m. On the basis of the comparative quantitation of...

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... that the maximum stability and activity of the AAP occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different ... Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F.(1991) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeiana and R. japonica and liverribonuclease ... of AAP, as described in the Materials and methods. Completion of the hydrolysis wasconfirmed by the disappearance of the (Met1)-ONC(M23L) signal in the MALDI-TOF mass spectra 1 h after the addition...

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTACTTGAGTCASynthesis of O1 DNAIIa ATTCAACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTASynthesis of O2 andO1O2 DNAsIIb TACTTGAGTCAACATAAAAGTTTGCTTTTCGTGTATTTTTTTGTTGAATSynthesis of O2 DNAPCI51 ... PurposepHC1 GGATCCTAAATCTTCTTGAGTAC Synthesis of O andO1O2 DNAspHC2 GAATTCTTGGTTCTATAGTATCTG Synthesis of O DNAPCR11 GACTCAAGTACACGTATCGTGTATAGTAGGTTTASynthesis of O1DNAPCR21 AAACCTACTATACACGATACGTGTACTTGAGTCASynthesis...

Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx

... However, the position of the samples in Fig. 4A is inﬂuenced by the level of all variables in these samples. For example, the samples of the strains in the third quadrant of Fig. 4A have a tendency ... proton upon the uptake of a nitrate ion. The added titrant in the stationary phase of both ammonium and nitrate cul-tures was NaOH, which was caused by equivalentquantities of organic acid produced ... The assays for G6P, F6P, PYR, ADP, AMP, NAD and ATPwere also as described by Ruijter and Visser [41]. The assay for 6PG was the same as for G6P, except that G6PDH wasexchanged with 6PGDH. The...

Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx

... via Mechanical TurkCrowdsourcing services such as AMT have madelarge-scale data annotation and collection efforts ﬁ-nancially affordable by granting anyone with ba-sic programming skills access ... restrict ourtask to Turkers who are located in the United States,and who maintain an approval rating of at least 90%.Turkers are allowed a maximum of 30 minutes towork on the HIT, and are paid one ... detection.Newman et al. (2003), and later Mihalcea andStrapparava (2009), ask participants to give boththeir true and untrue views on personal issues(e.g., their stance on the death penalty). Zhou etal....

Xem thêm