báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps
báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps
... [http://www.agreetrust.org/resource-centre/
training/ ].
doi:10.1186/1748-5908-6-81
Cite this article as: Brouwers et al.: E-learning interventions are
comparable to user’s manual in a randomized trial of training strategies
for the AGREE ... a traditional training
method using a PDF version of the User’sManualto
determine their effects on various me...
báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report" pptx
... effective.
Consent
Written informed consent was obtained from the patient
for publication of this case report and any accompany-
ing images. A copy of the written consent is available
for review by the Editor -in- Chief ... imaging showed no mass lesions in the pituitary
although a positron emission tomography scan showed abnormal pituitary activity. An abdominal compute...
Tài liệu Báo cáo khoa học: "Which words are hard to recognize? Prosodic, lexical, and disfluency factors that increase ASR error rates" ppt
... our analysis to other
ASR systems in order to determine the generality
of our findings, we have already gained important
insights into a number of factors that increase ASR
error rates. In addition, ... the log transform of pitch range was
originally based on the distribution of pitch range values in the
data set. Exploratory data analysis also indicated that using...
Báo cáo khoa hoc:" Pituitary macroadenomas: are combination antiplatelet and anticoagulant therapy contraindicated? A case report" pot
... Circulation 2003, 108:1682-1687.
13. Kawasaki T, Azuma A, Sawada T, Sugihara H, Kuribayashi T, Satoh M,
Shimizu Y, Nakagawa M: Electrocardiographic score as a predic-
tor of mortality after subarachnoid ... considered
a relative contraindication for anticoagulation. These
patients should be warned about the potential risks of
anticoagulation with respect to their pituitary aden...
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... GGAAGTCTCCCTTCCCAGAC CGATTTGCTGACCACCTTCT
MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC
MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA
MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG
MLL4 GTCTATGCGCAGTGGAGACA ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC
ERa antisense CATGGTCATGGTCAG
a
ERb antisense GAATGTCATAGCTGA
a
MLL1 antisense TGCCAGTCGTTCCTCTCCAC
a
MLL2 antisense ACTCTGCCACTTCCCG...
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... isopropylamine, n-
butylamine, n-amylamine, n-hexylamine, 1,6-diamino-
hexane, and spermidine. Interestingly, the enzyme was
unable to use ammonia as a substrate and was distinct
from alanine dehydrogenase ... Toyobo (Osaka, Japan), and New England
Biolabs (Beverly, MA, USA). All other reagents were of
analytical grade from Nacalai Tesque (Kyoto, Japan) and
Wako Pure Chemical Industri...
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf
... Stimulation of both
the calmodulin kinase II and Akt kinase pathways are
responsible for the upregulation of the p65 subunit of
NF-jB [22]. Activation of PI3K, mitogen-activated
protein kinase kinase ... ‘classic’ pathway and the
‘alternative’ pathway, which result in the release of
NF-jB from its inhibitors and in the nuclear localiza-
tion of NF-jB [7]. The...
Báo cáo khoa học: "Using Conditional Random Fields to Predict Pitch Accents in Conversational Speech" pptx
... of pitch accent. While
certainly all of these variables are not independent
of on another, using CRFs, one can incorporate all
of these variables into the pitch accent prediction
model with the ... (6)
Rather than using mutual information as a measure
of collocational strength, we used unigram, bigram
and joint probabilities. A model that includes both
joint probability an...
Báo cáo khoa học: Immunonanoparticles ) an effective tool to impair harmful proteolysis in invasive breast tumor cells docx
... membrane proteins of MCF-7
human invasive ductal breast carcinoma. Using immuno-
cytochemical analysis, its positive staining was detected
predominantly in primary breast carcinomas and in meta-
static ... an excessive intracellular proteolytic activ-
ity of cysteine proteases, resulting in the
degradation of extracellular matrix. Cysteine
protease inhibitors are capable of...
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc
... or decreasing the stability of uPA mRNA
and therefore impairing or favoring their degradation.
As the uPA mRNA of certain human tumor cell lines
is more stable than that produced by normal cells ... argues in
favor of combinatorial miR target regulation, in
which the translatability of uPA and c-met mRNAs
may be subject to combinatorial regulation by multi-
ple miRs, inclu...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- báo cáo khoa học về cá tra
- báo cáo khoa học nghiên cứu chôm chôm
- trạng thái hiện sinh báo cáo khoa học
- biểu tượng văn học báo cáo khoa học
- tài liệu báo cáo khoa học
- cách trình bày báo cáo khoa học
- báo cáo khoa học toán học
- cách làm báo cáo khoa học
- trình bày báo cáo khoa học
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Chuong 2 nhận dạng rui ro
- BT Tieng anh 6 UNIT 2
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật