0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " A comparative evaluation of the process of developing and implementing an emergency department HIV testing program" pps

báo cáo khoa học:

báo cáo khoa học: " A comparative evaluation of the process of developing and implementing an emergency department HIV testing program" pps

... MH074369 (T.L.). The authors would like to thank Kama Brockman at the California Office of AIDS and the participants of this study.Author details1San Francisco General Hospital HIV/ AIDS Division, ... conceived the study and obtained research funding. KC,KK, SW, and TL collected the data. KC, KK, and SW analyzed the data. KCdrafted the manuscript and all authors contributed substantially to ... 6:30http://www.implementationscience.com/content/6/1/30Page 8 of 9RESEARCH Open Access A comparative evaluation of the process of developing and implementing an emergency department HIV testing programKaterina A...
  • 9
  • 320
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf

... for an acceptable trans- lation. Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier are siblings ... non-hierarchical conceptual information and speech act information. Penman has a rich variety of inquiries dealing with such information and so makes available a large set of resources and capabilities ... are taxonomic. These relate particular instances of what is to be expressed to the categories of semantic organisation that the grammar's seman- tics requires. These categories, and the...
  • 9
  • 680
  • 1
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary ... this approach is that it allows only as many senses as clusters, thereby limiting the granularity of the meaning space. This problem is avoided by Neill (2002) who uses local instead of global ... senses thereby avoiding the mixing beforehand. In this paper we suggest to look at lo-cal instead of global co-occurrence vectors. As can be seen from human performance, in almost all cases the...
  • 4
  • 536
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... to amplify omcA (lane 2), omcB (lane 3), mtrA(lane 4) and mtrB (lane 5) in the omcA–mutant, and omcA (lane 7),omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB–mutant. MR-1R was...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

... be processed with our algo-rithms (SVD and clustering), we decided to restrict the number of rows to a vocabulary appropriate for evaluation purposes. Since we are not aware of any standard ... (1992). Class-based n-gram models of natural language. Computa-tional Linguistics 18(4), 467-479. Clark, Alexander (2003). Combining distributional and morphological information for part of speech ... dendrogram it has been conducted. Without SVD the expected clus-ters of verbs, nouns and adjectives are not clearly separated, and the adjectives widely and rural are placed outside the adjective...
  • 4
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt

... appropriate name. The three “palatable” neolo-gisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat). These three suggestions areamusing ... com-munications are available. Kohli et al. (2005) ana-lyzed consumer evaluations of meaningful and non-meaningful brand names and the results suggestedthat non-meaningful brand names are evaluated ... areamusing and have a nice ring to them. As a matter of fact, it turns out that the name Eatalian is actuallyused by at least one real Italian restaurant located inLos Angeles, CA3.For the...
  • 9
  • 518
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx

... Initially, a synthetic DNA target was used to optimize the assay to assess the signal-to-noise ratios with a relatively large dynamic range and the highest signal obtainable. The standard lateral-flow ... after challenge gave positive signals in the biosensor assay, which concurred with the MAP culture 36 Vijayarani Kumanan et al.handle systems for the detection and quantification of RNA molecules ... Vijayarani Kumanan et al.Specificity of the assay The specificity of the lateral-flow biosensor assay was evaluated with samples from closely related mycobacteria for false positive reactions....
  • 8
  • 385
  • 0
báo cáo khoa học:

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

... review and wrote the manuscript. RC and PH supervised the study and proof-read the manuscript. All authors read and approved the final manuscript.Competing interests The authors declare that they ... than 5 cm (pT1 and pT2 stage) and all the patients had wide local excisions performed. The slides and b locks were retrieved from the archives of the Anatomical Pathology Department, GSH and the two ... perform and will play more of a role in the futuremanagement of cancer [1]. The cell cycle is fundamental to all eukaryotic cells and it has been the focus of many studies [2]. An abnormal cel...
  • 9
  • 423
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

... reducing the tumor size and facilitating surgical resection.Conclusion: A well-planned multidisciplinary approach should be part of the standardmanagement of advanced or metastatic GIST.BackgroundGastrointestinal ... cells of Cajal [1]. They affect mostly malesbetween the ages of 50 and 70, and are usually found inci-dentally at early stages [1-4]. Large or advanced lesionsmay present with a variety of clinical ... hospitalization. The postoperativecourse was complicated by the formation of a subhepaticabscess that was successfully treated with drainage cathe-ters and systemic antibiotics. Imatinib was...
  • 4
  • 454
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ