0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Individual determinants of research utilization by nurses: a systematic review update" pot

báo cáo khoa học:

báo cáo khoa học: " Individual determinants of research utilization by nurses: a systematic review update" pot

... contextual, and organizational) associatedwith research utilization. In a previous systematic review of individual characteris-tics related t o research utilization by nurses, Estabrookset al. ... As part of a larger systematic review on research utilization instruments, 12 online bibliographicdatabases were searched. Hand searching of specialized journals and an ancestry search was also ... 3.0).Data extraction and analysisOne reviewer (JES) extracted data from all included arti-cles. Extracted data was double checked by a research assistant for accuracy. Data were extracted on...
  • 20
  • 248
  • 0
Báo cáo khoa học: Structural determinants of protein stabilization by solutes The importance of the hairpin loop in rubredoxins pdf

Báo cáo khoa học: Structural determinants of protein stabilization by solutes The importance of the hairpin loop in rubredoxins pdf

... theaddition of an extra negative charge in an already neg-atively charged patch. The mutation D2K, by contrast,caused only a small decrease of stability (20%).Although this residue does not appear ... has a net charge identical to that of theparent Rd, whereas mutant D23|29 shows a decrease of two positive charges and mutant D17|29 has a net loss of one positive charge. In the case of mutant ... kinetics of RNase A and the urea : TMAO paradigm. Biochem-istry 42, 5837–5849.4 Batchelor JD, Olteanu A, Tripathy A & Pielak G(2004) Impact of protein denaturants and stabilizers onwater...
  • 13
  • 405
  • 0
báo cáo khoa học:

báo cáo khoa học: "What implementation interventions increase cancer screening rates? a systematic review" pps

... Canada.8Department of Family Medicine, McMaster University, Hamilton, Ontario, Canada.9PrimaryCare, Cancer Care Ontario, Toronto, Ontario, Canada.10Prevention andScreening, Cancer Care ... Care Ontario, Toronto, Ontario, Canada.11PopulationHealth Research, Alberta Health Services - Cancer Epidemiology, Preventionand Screening, Calgary, Alberta, Canada.12Department of Health ... Prevention and Early Detection NetworkHamilton, Niagara, Haldimand, Brant, Ontario, Canada.15Systemic, Supportiveand Regional Cancer Programs, Juravinski Cancer Centre, Hamilton, Ontario,Canada.16Faculty...
  • 17
  • 241
  • 0
báo cáo khoa học:

báo cáo khoa học: " Do self- reported intentions predict clinicians'''' behaviour: a systematic review" ppt

... Type of participants2. Target population3. Sampling strategyParticipants approached and analysed1. Theoretical framework2. Target behaviourMeasure of intentionMeasure of behaviour ... Number of participants approached; n = Number of participants analysed; % = Percentage of participants approached who were analysed; Psy = Psychometrics;Meth = Method of ascertainment of behaviour; ... wasapproached; and if the population was sampled, whetherit was a valid random (or systematic) sample. Susceptibil-ity to bias was assessed on the basis of the percentage of participants approached...
  • 10
  • 247
  • 0
Tài liệu Báo cáo khoa học: Molecular determinants of ligand specificity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc

Tài liệu Báo cáo khoa học: Molecular determinants of ligand specificity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc

... carbohydrate conformation. Proc Natl AcadSci U S A 98, 10541–10545.35 Basma M, Sundara S, Calgan D, Venali T & Woods RJ(2001) Solvated ensemble averaging in the calculation of partial atomic ... interact mainly by hydrogenbonds, with a central area of CtCBM11 containingthe amino acids Asp99, Arg126, Asp128 and Asp146and, in the case of the larger ligands, with Asp51. Itis important ... Nova de Lisboa, Caparica, Portugal2 REQUIMTE, Departamento de Quı´mica, Faculdade de Cieˆncias do Porto, Portugal3 Centro Interdisciplinar de Investigac a o em Sanidade Animal, Faculdade...
  • 12
  • 687
  • 0
Báo cáo khoa học: Identifying determinants of NADPH specificity in Baeyer–Villiger monooxygenases docx

Báo cáo khoa học: Identifying determinants of NADPH specificity in Baeyer–Villiger monooxygenases docx

... PR440Af,5¢-GTCGGCGGTAAGGCGATCGTACGAGATAAC-3¢and PR440Ar, 5¢-GTTATCTCGTACGATCGCCTTACCGCCGAC-3¢. The underlined bases indicate the bases thatwere altered to create an alanine codon.For saturation ... respectively):PR339Af, 5¢-GAAGGTCTTTGCGGCGACCACCAACTG-3¢ and PR339Ar, 5¢-CAGTTGGTGGTCGCCGCAAAGACCTTC-3¢; PK439Af, 5¢-CCTGTCGGCGGTGCGCGCATCGTACGAG-3¢ and PK439Ar, 5¢-CTCGTACGATGCGCGCACCGCCGACAGG-3¢; ... mutation K32 6A in CHMO was created usingthe primers PK326Af, GATTTGTATGCAGCGCGTCCGTTGTG and PK326Ar, CACAACGGACGCGCTGCATACAAATC (the underlined bases indicate the basesaltered to create an...
  • 10
  • 418
  • 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

... P1,P5-di(adenosine-5¢)-pentaphosphate(Ap 5A) as inhibitor of adenylate kinase to preventdepletion of available ATP and ADP and to maintainsteady-state respiration. Instead, we did a theoreticalcalculation of the extramitochondrial ... dicarboxylate carrier and sub-strate dehydrogenases (malate and NADH dehydrogenases in the case of glutamate plus malate oxidation, or succinate dehydrogenase inthe case of succinate oxidation); ... Furthermore, an imbal-ance in fatty acid metabolism resulting in activation of nonoxidative rather than oxidative pathways andaccumulation of biologically active molecules [e.g.long-chain acyl-CoAs...
  • 15
  • 546
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... 1e+06size(KB)recallprecision434Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435,Sydney, July 2006.c2006 Association for Computational Linguistics428 ... 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1recallprecisionBincreaseBordinaryBmax433432431430...
  • 8
  • 395
  • 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

... isomerization. ProcNatl Acad Sci USA 93, 13048–13053.28 Oikawa K, Nakamura S, Sonoyama T, Ohshima A, Kobayashi Y, Takayama SJ, Yamamoto Y, UchiyamaS, Hasegawa J & Sambongi Y (2005) Five amino ... JapanIntroductionCytochromes c¢ are classified as class II cytochromes caccording to Ambler [1], and are found in the peri-plasm of certain Gram-negative Alpha-, Beta- andGammaproteobacteria. Recent biochemical and geneticanalyses ... Satoshi Wakai1, Hirofumi Nishihara2and Yoshihiro Sambongi11 Graduate School of Biosphere Science, Hiroshima University, Japan2 Faculty of Agriculture, Ibaraki University, JapanIntroductionCytochromes...
  • 8
  • 606
  • 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

... immunoprecipitates including DNA were analyzed by PCR (primers: Fw, 5¢-CCAGACAATCGTCTCGCCCA-3¢;and Rv, 5¢-GGCTAGGTAACAGTTTAGCGAGGA-3¢).Rat genomic DNA extracted from rat primary hepatocyteswas used as a ... 5¢-GAAAGAUGGCAGAAUAGAATT-3¢; andscrambled c-Jun siRNA3 Se, 5¢-GAAAGCCUUAAGAAUUGUATT-3¢). The transfection of rat primary hepatocyteswith siRNA(s) was carried out by electroporation with theNucleofection ... siRNAs were synthesized by Sigma Genosys (scrambled c-Fos siRNA Se, 5¢-GUACGCUACCACACUUGAUTT-3¢; scrambled c-Jun siRNA1 Se,5¢-GGGAACAGAGCGGAUAGGATT-3¢; scrambled c-JunsiRNA2 Se, 5¢-GAAAGAUGGCAGAAUAGAATT-3¢;...
  • 9
  • 556
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam