báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx

... article as: Bonner et al.: ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system. Implementation Science2010 ... 5:63http://www.implementationscience.com/content/5/1/63Page 8 of 8RESEARC H ARTIC LE Open Access ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a ... Angeles, CA, USA.7VA South Central MentalIllness Research, Education, and Clinical Center, Central Arkansas Veterans Healthcare System, North Little Rock, AR, USA.8University of Arkansas forMedical...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 ... iron-dependent.Characterization of the kinetic parameters of the enzymatic activity of zebraﬁsh RPE65cTo determine the steady-state kinetics of the enzymaticactivity of zebraﬁsh RPE65c, the assay conditions...

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... most of the proteincomponents are integral in the membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These proteins are ... mitochondrial outermembrane The data presented here show that most of the proteinassociated with the yeast mitochondrial outer mem-brane in yeast is integral in the membrane and most of the integral ... Cam-ougrand N, Grandier-Vazeille X, Larsson C, PahlmanIL, Manon S & Gustafsson L (2004) Organization andregulation of the cytosolic NADH metabolism in the yeast Saccharomyces cerevisiae. Mol...

Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

... of Ca2+channels, either localized in the membranes of intracellular Ca2+stores or in the plasma membrane.Such Ca2+entry channels in the plasma membraneand Ca2+release channels in intracellular ... pharmaceuticalapplications as compared to the cADPR analoguesavailable so far.ConclusionAlthough the molecular mechanism of receptor-medi-ated formation of cADPR is still mysterious in manyaspects, ... via a separate cADPR binding protein. In addition to Ca2+release, cADPR also evokes Ca2+entry. The underlying mechanism(s) maycomprise activation of capacitative Ca2+entry and ⁄ or activation...

Tài liệu Báo cáo khoa học: Kinetic basis for linking the ﬁrst two enzymes of chlorophyll biosynthesis doc

... quenched-ﬂow analysis reveals that ChlH dramat-ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... curve. The maximumrate during an assay was taken as the steady-state rate andoccurred at the beginning of the reaction.Quenched-ﬂow measurementsPre-steady state time samples from ChlM-catalysed ... [15–20]. AsMgP is also the product of the magnesium chelatasereaction, this emphasizes the importance of quantita-tive studies not only of the methyltransferase andchelatase, but also of the interaction...

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... FEBSStaphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acidYang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria SelmerDepartment of Cell and Molecular ... linker has ﬂipped away tocreate the 40 A ˚shift of domain IV relative todomain IIIMutation to a larger side chain may change the relative positions of domain III and V [16] as well as the position ... ribosome. The contacts of domain V with domains G and III undergo largechanges between the free and ribosome-bound states of EF-G, and thus the same mutations can also affect the conformational dynamics...

Báo cáo khoa học: Protein transport in organelles: The Toc complex way of preprotein import pdf

... C-terminal partappears to play an essential role in retaining Toc75 at the outer chloroplast membrane [35]. With the exception of atToc75-I (At1g35860 ⁄ 80), all A. thaliana Toc75 paralogs are expressed ... state anddo not give any clues on the activation mechanism.As a result of crystal and biochemical studies on the Toc33 homodimer, a signiﬁcant advance in the under-standing of Toc GTPases has ... as a classical transit sequence,whereas the bulk of the Toc75 molecule is retained at the outer membrane. The N-terminal part reaches the chloroplast stroma where it is cleaved by the stromalprocessing...

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... NaN3. Traces are the average of duplicates. The precipitation of ADH was completely suppressed atan Hsp25 : ADH ratio of 1.4 : 1.0. The Q19 4A mutant showed comparable chaperone activity with the ... precipitation to the wild-type protein.Taken together, the thermal and reduction stressassays demonstrate that each of the glutamic acidmutants, in particular E19 0A and E20 4A, are signiﬁ-cantly ... FEBSResultsSequence analysis of the C-terminal extensions of mammalian sHsps The C-terminal extensions of mammalian sHsps arehighly variable in length and sequence, yet they share the characteristics of being...

Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

... vector The gene coding for Lys33GP was constructed by the SOE-PCR strategy, using primer 1 (5¢-GTGAATTCCTGGAAGTTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAGCGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢)and primer ... N-terminalsequence (IPPQCH) of BBI, was paired with the abridgeduniversal amplification primer. The 3¢-end partial cDNA of BBI was then amplified by PCR. The PCR product contain-ing a polyA tail was ... Othersolvents and reagents were of analytical grade.cDNA cloning of MBTIAbout 1 g of mung bean seeds at the late germinating stagewas ground to fine powder in liquid nitrogen, and the totalRNA was then...

Báo cáo khoa học: "RELATING SYNTAX AND SEMANTICS: THE SYNTACTICO-SEMANTIC LEXICON OF THE SYSTEM VIE-LANG" doc

... of a case grammar. This leads to a correspondence between roles in the net and surface cases within the sentence. Cases of a case grammar at the one hand show regularities in their relation ... University of Vienna, Austria ABSTRACT This paper describes the structure and evaluation of the syntactico-semantic lexicon (SSL) of the German Natural Language Understanding System VIE-LANG [3]. ... with the LS: (CASE ACC) is a recursive call to the generator with the current individual, BOOK-4, as new root node together with the information that the result shall bear accusative case...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thơ nôm tứ tuyệt trào phúng hồ xuân hương BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ