báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps

báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps

báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps

... physiotherapists and occupational therapists, and involvement of t herapy assistants. Role sharing and expansion are examples of organisational interventions [35]. A more in-depth examination of how ... study was to design, test, and evaluate the impact of an implementation program intended to change the behaviour of community rehabilitation teams. A secondary aim wa...
Ngày tải lên : 10/08/2014, 10:23
  • 10
  • 295
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... ligands at an average distance of 1.90 A ˚ and four nitrogen(oxygen) ligands at an average distance of 2.06 A ˚ . Three of the four ligands were reported to be consistent...
Ngày tải lên : 18/02/2014, 06:20
  • 15
  • 624
  • 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

... cor- pora with different and incompatible anno- tation guidelines or standards. This seems to be a great waste of human efforts, and it would be nice to automatically adapt one annotation standard to ... ACL and AFNLP Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study Wenbin Jiang † Liang Huang ‡ Qun Liu † † Key Lab. of I...
Ngày tải lên : 17/03/2014, 01:20
  • 9
  • 404
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , Harry Boer 2 , ... observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank database under t...
Ngày tải lên : 14/02/2014, 18:20
  • 13
  • 888
  • 0
Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

... oligonucleotides, 5¢-GATGAATTCGGAGGTTTAAATTTATGTACCAAC CTGTCGCTCTATTTA-3¢ and 5¢-CAATTCAAGCTTAA TGATGATGATGATGATGCTCCAGTTCATAACGTAA AGCCTCAGCGG-3¢. The amplified DNA was digested with Eco RI and HindIII, and then ... region of pJY310 [7] was amplified by PCR using a pair of oligonu- cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAAT AAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAG TTTTTGTTCCACCAATATCAAAC...
Ngày tải lên : 19/02/2014, 00:20
  • 10
  • 530
  • 0
Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

... Scarpa A, van Tilborg AA, Leenstra S, Zanon C & Bardelli A (2007) Novel somatic and germ- line mutations in cancer candidate genes in glioblas- toma, melanoma, and pancreatic carcinoma. Cancer Res ... Yan H, Gazdar A et al. (2006) Somatic mutations of GUCY2F, EPHA3, and NTRK3 in human cancers. Hum Mutat 27, 1060– 1061. 15 Balakrishnan A, Bleeker FE, Lamba S, Rodolfo M, Daniotti M,...
Ngày tải lên : 16/03/2014, 02:20
  • 10
  • 441
  • 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

... Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori Kanaya Department of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella ... the NdeI–BamHI sites of pET-2 8a. This DNA fragment was amplified by PCR. The sequences of the PCR primers were 5¢-AGAGAGAATT CATATGTCAGATTTGTTCAG-3¢ for the 5¢-primer and 5¢-GGCCACT...
Ngày tải lên : 16/03/2014, 16:20
  • 10
  • 436
  • 0
Báo cáo khoa học: "The Parameters of an Operational Machine Translation System" doc

Báo cáo khoa học: "The Parameters of an Operational Machine Translation System" doc

... contemplate the existence of more than one translation center for Russian language materials for the immediate future. However, as our capability grows and we are able to handle new languages and ... postulate the state of the art of machine translation to be of a sufficient level to warrant opera- tional machine translation production from Russian- language materials,...
Ngày tải lên : 16/03/2014, 19:20
  • 4
  • 320
  • 0
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

... GGCGGGACCTGACACCACCACTGACA SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA SaRPL2 7a- FW AAGAGGAACACAACTCACTGCCCCAC SaRPL2 7a- RV ... with S. aurata ribosomal protein L2 7a (SaRPL2 7a, GenBank accession number AY188520) signals. Northern blot analysis Ten micrograms of total RNA was fractionated on a 1.2% formaldeh...
Ngày tải lên : 23/03/2014, 07:20
  • 12
  • 445
  • 0

Xem thêm

Từ khóa: