báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

... 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGGACTGTCAATCAAATGTGATTA3’LV- COX-2siRNA-3 Oligo1: 5’TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTTAGAGAAGGTTTTTTTTC3’Oligo2: 5’TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAATAGGAGAGGTTAGAGAAGGTTA3’ The ... 5’TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTGCACTGTGTTTTTTTTTC3’Oligo2: 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAAGTATGTAGTGCACTGTGTTTA3’LV- COX-2siRNA-2 Oligo1: 5’TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATCAAATGTGA TTTTTTTTC3’Oligo2: ... on invasion and migration ability of SaOS2 cellsMatrix invasion and migration abilities of cancer cellsare associated closely with metastatic potential. The in vitro cell invasion and migration...

báo cáo khoa học: "Quantum dot-induced cell death involves Fas upregulation and lipid peroxidation in human neuroblastoma cells" pptx

... (FADD) to the DeathDomain in the cytoplasmic tail of the receptor, and canlead to caspase activation and cell death [22]. Down-stream signaling of Fas can also induce activation of lipases and ... whichrecruits caspase-8 or caspase-10, and forms the death-inducing signaling complex (DISC). Caspases-8/10 auto-catalyze their own cleavage [43-45], triggering a cascade of caspase activation that culminates ... by the Juvenile Diabetes Research Foundation (Canada) and the Canadian Institutes of Health Research. The authors would like to thank J. Laliberté for assistance with confocal microscopy and...

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... Stephanou A, Isenberg DA, Nakajima K & LatchmanDS (1999) Signal transducer and activator of transcrip-tion-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and ... TGGACGCGCGTAACCCGCACAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()298) Sense GCGCTGAAGCGCAGGCGGTCAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()194) ... between)1860 and ) 656 (forward, 5¢-TCT ATC TCT CGA TGGATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTAGGT CAC T-3¢). Knockdown of Hsp10 5a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon;5¢-GCA...

Báo cáo khoa học: Green ﬂuorescent protein-tagging reduces the nucleocytoplasmic shuttling speciﬁcally of unphosphorylated STAT1 potx

... [10,30]. The construct pSTAT1-NES-GFP was generated by PCR ampli-ﬁcation of pGST-NES-GFP using the primer pair 5¢-ATATATGGATCCAGATAAAGATGTGAATGAG-3¢ and 5¢-CGCCCCGACACCCGCCAACACCC-3¢ and VentDNA ... that an identical quantity of each activated STAT1 variant was incubated with the radioactive DNAprobe. Shown is the autoradiogram of the native PAGE. (C) U 3A cells were cotransfected with plasmids ... homodimers of recombinantSTAT1-GFP (upper mark), and of heterodimers thereof (asterisk) are indicated at the right margin of the gel. The arrowhead marks an unspe-ciﬁc band. Included are whole...

Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx

... of new varieties. Kohlrabi and Brassica vegetables are now planted with increasing percentage of new varieties (See Table 2 for more detail). The data shows that three years after the implantation ... implantation of the project, awareness of the farmers about use of new varieties have been improved, and many have used improved varieties. Seed sources and methods of propagation have not changed. ... leafy vegetables, Brassica vegetables, cabbage, The number of pesticides and chemicals used has generally decreased while at the same time there has been an increase in the usage of bio-pesticides...

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " First Six-Monthly Report docx

... aspects of the GAP manual and particularly the quality assurance aspects based on the NSW Department of Primary Industries FreshCare® program. iii. Watermelon varieties planted and harvested ... demonstration variety and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain, intensive training of ... Vietnamese horticulturalists in Australia and the delivery of a large workshop at the end of the project to ensure the information is available to as wide an audience as possible. There...

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS6 pdf

... temperature management and packaging along the supply chain, intensive training of Vietnamese horticulturalists in Australia and the delivery of a large workshop at the end of the project to ensure the ... several training initiatives. Such as the establishment of demonstration variety and GAP trials which are the basis of farmer field days, postharvest research investigating temperature management ... period on the harvesting and handling of cabbage as well as the production of watermelon. (ix) Trainer of Trainer workshops were presented at ASINCV by Dr Jobling and Mr Baker on cabbage harvesting,...

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS7 ppt

... Australian Organisation Applied Horticultural Research Pty. Ltd.(AHR) ACN 073 642 510; Suite 352 Biomedical Building 1 Central Ave, Everleigh NSW 2015 Australia Australian Personnel Prof. ... 352, Biomedical Building, 1 Central Avenue, Australian Technology Park, Eveleigh N.S.W. 2015 Australia Email: gordon@ahr.com.au In Australia: Administrative contact Name: Lynn Christie ... Administrator Fax: +61 2 9544 3782 Organisation AHR, Applied Horticultural Research, PO Box 3114, Bundeena NSW 2230, Australia Email: lynn@ahr.com.au In Vietnam Name: Dr Pham Van...

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS8 doc

... horticulturalists in Australia and the delivery of a large workshop at the end of the project to ensure the information is available to as wide an audience as possible. Another important aim is ... and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain, intensive training of Vietnamese ... • Traditional marketing can limit farmer returns The project will use a participatory approach to encourage the uptake of good agricultural practices (GAP) by the collaborating Vietnamese...

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS10 pdf

... pre- and post training analysis) of change in awareness and competency levels of research and extension workers, farmers and private sector input suppliers and marketers) in 1. Potential and ... post harvest handling and IPM (problem identification and management options) There has been a significant investment of project time in the development and implementation of IPM and postharvest ... retail markets in Hanoi from the Nghe An region. The farmers have also diversified into supplying other safe vegetables including Chinese cabbage, tomatoes and carrots to retail markets in Hanoi....

Xem thêm