báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... regimen followed by 90 yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases. Journal of Experimental & Clinical CancerResearch ... follicular lymphoma: a report of 9 casesFrancesco Pisani 1* , Carlo Ludovico Maini 2 , Rosa Sciuto 2 , Laura Dessanti 1 , Mariella D’Andrea 1 , Daniela Assisi3,Maria Concetta Petti 1 AbstractBackground: ... CAS E REP O R T Open Access FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90 yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular...
- 5
- 287
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... sensitivity determinant of CPT1B J. Relat et al. 21 4 FEBS Journal 27 6 (20 09) 21 0 – 21 8 ª 20 08 The Authors Journal compilation ª 20 08 FEBSCPT1 assayCPT1 activity was assayed by the forward exchange methodusing ... performed at 1 mm carnitine as standard. To analyzePigE17DCPT1B and HumanD17ECPT1B mutants, the assay was performed at carnitine concentrations equal to the Km. The percentage of activity was ... presence of increasing malonyl-CoA concentrations(from 0 to 15 lm for P50H, H50P, P 128 H, H 128 P,PigE17DCPT1B and HumanD17ECPT1B, and from 0 to500 lm for D 18 PigCPT1B and D28PigCPT1B). The assaywas...
- 9
- 550
- 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx
... withSpecial Attention to Radiation Necrosis. Neurosurgery 20 04, 54 :11 11- 111 9. 19 . Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T,Ohata K: Diagnostic accuracy of 11 C-methionine ... RecommandationsCommittee: Canadian recommendations for treatment of glioblastomamultiforme. Current Oncol 20 07, 14 :11 0 -11 7.doi :10 .11 86 /17 48- 717 X-5 -9 Cite this article as: Meyzer et al.: A case report ... progression.ConsentWritten informed consent was obtained from the par-ents and the patient for publication of this case report and accompagnying images. A copy of the written con-sent is available for review by the...
- 5
- 425
- 0
báo cáo khoa học: "Use of RE-AIM to develop a multi-media facilitation tool for the patient-centered medical home" potx
... 20 02 February ;25 (2) : 3 19 -23 . (11 ) Srinivasan M, Przybylski M, Swigonski N. The Oregon Health Plan: predictors of office-based diabetic quality of care. Diabetes Care 20 01 February ;24 (2) :26 2-7. ... primary care setting. Diabetes Care 20 01; 24 (1) :22 -6. (13 ) Chin MH, Zhang JX, Merrell K. Diabetes in the African-American Medicare population. Diabetes Care 19 98 ; 21 ( 7) :10 90 -5. (14 ) Davidson ... Diabetes care in health maintenance organisation and fee -for- service settings. Disease Management and Health Outcomes 19 97 ;2 :18 9- 97. (15 ) Davidson MB. The case for ‘outsourcing’ diabetes care....
- 31
- 351
- 0
Báo cáo khoa hoc:" False rumours of disease outbreaks caused by infectious myonecrosis virus (IMNV) in the whiteleg shrimp in Asia" pdf
... 0 22 / 12 / 09 10 10 0 0 22 / 01/ 10 2 2 0 0 16 /03 /10 3 3 0 0Malaysia 22 /08/06 5 5 0 0Taiwan 10 / 09/ 07 3 3 0 0Vietnam07 /11 /06 2 2 0 0 25 / 01/ 10 3 3 0 0 21 / 06 /11 4 4 0 0India 20 / 02/ 09 3 3 0 0 17 /03 /10 2 2 ... 004 /10 /06 15 0 15 0 28 /11 /06 2 2 0 004/05/07 10 4 6 008/06/07 8 4 4 0 10 /06/ 09 20 20 0 0 26 /06/ 09 5 0 5 0 09/ 07/ 09 3 2 1 0 20 /10 / 09 7 0 7 0 29 /03 /10 2 2 0 0Thailand 15 / 09/ 06 7 7 0 0 02 /10 /06 24 ... 0Totals 19 3 15 1 42 0Source and test results for P. vannamei samples submitted by Asian shrimpfarmers and tested for IMNV and PvNV from the years 20 06 -2 011 .Senapin et al. Journal of Negative...
- 5
- 373
- 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... 0 .17 9. 21 ± 0.07 10 . 39 ± 0.08 11 .08 ± 0 .10 9. 96 ± 0. 21 8.08 ± 0 .23 Spleen 7.45 ± 0.06 8. 71 ± 0 .10 9 .17 ± 0.07 10 .20 ± 0 . 12 11 .16 ± 0 .14 11 .99 ± 0.07 10 .14 ± 0 .23 8 .97 ± 0 . 19 Lung 0 5 .90 ± 0 . 19 ... ACTGTGTTTCCCATCCATTGG 3 12 2- 314 3GPV-FP 6FAM-FTCGCAATGCCAATTTCCCGAGGP TAMRA3 098 - 3 12 0VP3 -1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 16 58VP3 -2 GGATCCCGCCAGGAAGTGCTTTATTTGA 4637-4665Virology Journal 20 09, 6 :14 2 http://www.virologyj.com/content/6 /1/ 1 42 Page ... goslings.ResultsConcentration of standard pVP3 plasmid DNA The concentration of standard pVP3 plasmid DNA was 2 μg/μL, and the A2 60 /A2 80 (ratio) was 1. 84; the copynumbers of pVP3 plasmid DNA were 2. 76 × 10 11 copies/μL.Development...
- 7
- 338
- 0
Báo cáo y học: "A 12 Week, Open Label, Phase I/IIa Study Using Apatone® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy" pps
... 5 .23 > 60 Increased 13 3 52 16 3 Decreased 2. 79 8 .90 Increased 14 21 . 1 81. 7 Increased 7 .24 4.30 Decreased 15 54 .2 11 2 Increased 2. 91 2. 88 Decreased 16 22 .0 30 .9 Increased 6.54 6.58 Increased ... Decreased 3.00 6.30 Increased 4 14 .6 9 .14 Decreased 27 .6 57.05 Increased 5 4.38 3.65 Decreased 2. 76 9 .17 Increased 6 19 .3 - 8 .11 Decreased 12 .1 - 39. 5 Increased 7 9. 95 2. 74 Decreased 2. 72 13 .7 ... warranted for the use of Apatone as a co–adjuvant, or for emerging salvage chemotherapy in the treatment of late stage prostate cancer. Acknowledgements This research was supported by grants...
- 6
- 510
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... J Dairy Sci 20 06, 89 :18 42 -18 53. 9. Onwuegbuzie AJ, Leech N: A call for qualitative power analysis.Qual & Quan 20 07, 41: 105 - 12 1. 10 . Aagaard-Hansen J: The challenges of cross-disciplinaryresearch. ... Majoradvances in disease prevention in dairy cattle. J Dairy Sci 20 06, 89 : 12 67 - 12 79. Acta Veterinaria Scandinavica 20 09, 51: 36 http://www.actavetscand.com/content/ 51/ 1/36Page 3 of 10 (page number ... Acta Veterinaria Scandinavica 20 09, 51: 36 http://www.actavetscand.com/content/ 51/ 1/36Page 6 of 10 (page number not for citation purposes)cal analyses in the future, and they are highly...
- 10
- 587
- 0
Tài liệu Báo cáo khoa học: Modulation of F0F1-ATP synthase activity by cyclophilin D regulates matrix adenine nucleotide levels pptx
... Street, A5 01, New York, NY 10 0 21 , USAFax: + 21 2 000 0000Tel: + 21 2 746 4534E-mail: ans2 024 @med.cornell.edu(Received 9 June 2 010 , revised 22 January 2 011 , accepted 25 January 2 011 )doi :10 .11 11/ j .17 42- 4658 .2 011 .08 026 .xCyclophilin ... et al. Effect of CYPD on mitochondrial ATP flux ratesFEBS Journal 27 8 (2 011 ) 11 12 11 25 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 21 that only in the immunoprecipitates was a band of higher ... 1. 0AsO4 10 1.4 ± 3.4 a 11 3 .1 ± 4 .9 Vmax 14 5.0 ± 7 .2 14 6.4 ± 2. 9 ACI 3 .2 ± 0 .1 b3.7 ± 0 .2 +CsA, state 4 30 .2 ± 1. 4 32. 0 ± 0.7+CsA, AsO4 11 0.4 ± 4.7c 11 1.6 ± 1. 5+CsA, Vmax 13 9. 5 ± 10 .8 14 7.6 ± 2. 6+CsA,...
- 14
- 627
- 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... Glu1 32 in A. thaliana PS. Val 111 and Gly 113 , on the other hand,are both affected by both pantoate and ATP. Theseresidues have their positional equivalents in Val137 and Arg1 39 in A. thaliana ... 1. 06His34 1. 10Asp35 1. 75Gly36 1. 74Arg64 1. 89 Pro65 1. 32 Glu66 1. 57Asp67 1. 45Arg70 1. 10Tyr 71 1. 02 Pro 72 1. 06Thr74 1. 17Leu75 1. 13Gln76 1. 41 Glu77 1. 19 Lys96 1. 38Glu97 1. 27 Tyr 99 1. 07Pro100 1. 57Fig. ... Journal 27 7 (2 010 ) 697 – 7 12 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 697 0.34 A ˚in the A- chain and B-chain of nPS. Finally, for His37, the A- chain Ca atom is displaced by 0. 72 A ˚ and the...
- 16
- 791
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ