Báo cáo y học: "Kbus/Idr, a mutant mouse strain with skeletal abnormalities and hypophosphatemia: Identification as an allele of ‘Hyp’" pdf

... framework for perform-ing computational analyses, systematically repeating ana-lyses, capturing all details of performed analyses, and annotating analyses. Using Galaxy Pages, researcherscan communicate ... When a user performs an analysis using Galaxy,it automatically generates metadata for each analysisstep. Galaxy’s metadata includes every piece of informa-tion necessary to track provenance and ... histories. All datasets in a history - initial,intermediate, and final - are vie wable, and the user canrerun any analysis step.While Galaxy’s automatically tracked metadata aresufficient to repeat...

... arenecessary with this approach. However, two-staged sur-gery may be beneficial in elderly or patients with carotidartery stenosis, cardiomyopathy, coronary heart disease,history of pulmonary embolism ... lower cervical roots is rare[4]. The extra-dural component of a T1 -neuroma may present as an api-cal mass [5]. The diagnosis of T1 root neuromas may beparticularly complex and delayed due to absence ... nicely demonstrates that a Horner's syn-drome, if present and observed, along with a long history and slowly progression of hand weakness due to involve-ment of multiple nerves or roots...

... RESEARCH Open AccessKbus/Idr, a mutant mouse strain with skeletal abnormalities and hypophosphatemia: Identification as an allele of ‘Hyp’Kenji Moriyama1*, Atsuko Hanai2, Kazuyuki Mekada3, ... Sano M, Tokita Y, Masaki1 S, Inaguma Y, Hanai A, Sakurai N, Yoshiki A, Kusakabe M,Moriyama A, Nakayama A: Fates of Cdh23/CDH23 with mutationsaffecting the cytoplasmic region. Hum Mutat 2006, 27:88-97.3. ... mouse. Endocrinology 2010, 151:492-501.doi:10.1186/1423-0127-18-60Cite this article as: Moriyama et al.: Kbus/Idr, a mutant mouse strain with skeletal abnormalities and hypophosphatemia: Identification as an allele...

... inBehỗets disease and is usually characterized by severeheadache and deterioration in general condition.Infliximab, a chimeric monoclonal antibody to TNF -a, was developed and used to treat systemic ... this article as: Parentin et al.: Paediatric Behỗets disease presenting with recurrent papillitis and episcleritis: a case report. Journal of Medical Case Reports 2011 5:81.Submit your next manuscript ... scleritis is characterized by edema and injection in both the superficial and deep episcl eral ves-sels, and pain is usually severe and deep-seated. Finally,scleromalacia perforans is a necrotizing...

... Gupta et al.: Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report.Journal of Medical Case ... case of a pa tient with mixed-type AIHA who did not respond to steroid therapy butshowed a complete response to only one cycle of rituxi-mab. Refractory AIHA is a difficult condition to man-age, ... acquired hemolytic anemia. The cause of AIHA r emains idiopathic in 50% of thecases [1]. The clinical presentation of AIHA depends onthe subclass type: warm agglutinin, cold agglutinin and mixed...

... Baldwin and Sran, Delayed ethylene glycol poisoning presenting with abdominal pain and multiple cranial and peripheral neurop-athies: a case report Journal of Medical Case Reports 2010, 4:220Received: ... distribution, and reproduc-tion in any medium, provided the original work is properly cited. Case reportDelayed ethylene glycol poisoning presenting with abdominal pain and multiple cranial and peripheral ... normal but magnetic resonance imagingmay show abnormal enhancement of cranial nerve nuclei[6,7]. Neurophysiology may show a primary axonal poly-neuropathy [5,7], a primary demyelinating pathology...

... diverticulum presenting with combined bowel and urinary obstruction and mimicking Crohn’s disease: a case reportBanny S Wong1, David W Larson2, Thomas C Smyrk3, Amy S Oxentenko1*AbstractIntroduction: ... rectal lumen and base of the urinary bladder, associated with terminal ileal thickening and an ileocecal fistula. A flexible sigmoidoscopy with an endorectal ultrasound scandisplayed a complex abscess ... abscess with extensive mucosal and surrounding inflammation. An exploratory laparotomyrevealed a Meckel’s diverticulum with a large perforation at its base, positioned near the ileocecal fistula and immediately...

... rectal lumen and base of the urinary bladder, associated with terminal ileal thickening and an ileocecal fistula. A flexible sigmoidoscopy with an endorectal ultrasound scandisplayed a complex abscess ... with combined bowel and urinary obstruction and mimicking Crohn’s disease: a case reportBanny S Wong1, David W Larson2, Thomas C Smyrk3, Amy S Oxentenko1*AbstractIntroduction: Meckel’s diverticulum ... article as: Wong et al.: Perforat ed Meckel’s diverticulum presenting with combined bowel and urinary obstruction and mimicking Crohn’s disease: a case report. Journal of Medical Case Reports2010...

... modelsmodelling only two disease states (e.g. diseased andhealthy). PopMod of course includes the two- disease- state model as a special case.There is also heterogeneity other than of disease and ... of a systematic analytical approach to the modelling of disease interactions. This by itself represents a relatively impor-tant advance, as modellers have until now been con-strained to model ... explicitly analyses time evolution and, even moreimportantly, abandons the constraint of independence of disease states. A primary advantage of the approach adopted in PopModis the separate modelling...

... and prostate cancer. Endocr Relat Cancer 2003, 10:187-191.15. Tsugaya M, Harada N, Tozawa K, Yamada Y, Hayashi Y, Tanaka S,Maruyama K, Kohri K: Aromatase mRNA Levels in Benign Pro-static Hyperplasia and ... CentralPage 1 of 13(page number not for citation purposes)Theoretical Biology and Medical ModellingOpen AccessResearchCan a single model explain both breast cancer and prostate cancer? A Edward ... it had against PC. Anadditional protocol to consider for BC would be to usemaximum agonism of mAR and of iAR, or all mAR all iAR(AMAI). When LBNAR and MAV are added, this shouldhave a bcl-2...

... 86853546,86854566AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACGGTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTATATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTACTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGTTTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGATGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAAMESVLKGICAFVEVWSSSRTENYSKAFEQQLLDMGAKVSKTFNKRVTHVVFKDGHSTTWRKAQDAGVKTVSVLWVEKCRETGVRVDESLFPAVYNNDGLPLKHKCMQPKDFVEKTPENDRKLQRRLDRMAKELAQQRIGINAETDIPVLLFEDDGSLVYSPVSKIRDQCSEMERRINEMKEKRENLSPTASQMFQASPRCSQGDCPLSTSLTNSEDAVLQGEKKKDCLNSSFDDFFGTVTSKRQKKEVENTCNTQTCTHVSMSASKNSLSchr3_1359.1 ... 86853546,86854566AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACGGTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTATATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTACTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGTTTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGATGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAAMESVLKGICAFVEVWSSSRTENYSKAFEQQLLDMGAKVSKTFNKRVTHVVFKDGHSTTWRKAQDAGVKTVSVLWVEKCRETGVRVDESLFPAVYNNDGLPLKHKCMQPKDFVEKTPENDRKLQRRLDRMAKELAQQRIGINAETDIPVLLFEDDGSLVYSPVSKIRDQCSEMERRINEMKEKRENLSPTASQMFQASPRCSQGDCPLSTSLTNSEDAVLQGEKKKDCLNSSFDDFFGTVTSKRQKKEVENTCNTQTCTHVSMSASKNSLSchr3_1359.1 ... accept or reject the annotation into a commu-nity database for sharing with the community. Alternatively,annotations can be saved locally on the annotator's machineby displaying the annotation...