Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx
Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx
... during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysisKristin K Haga1*, Katie L McClymont1, Scott Clarke1, Rebecca S Grounds1, Ka Ying ... control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis. Journal of Cardiothoracic Surge ry2011 6:3.Submit your next manuscript ... the effects of tight versusnormal glycaemic control, during and after cardiac surgery, on measures of morbidity and mortality. Method: The literature was systematically reviewed, based on pre-determined...
- 10
- 850
- 0
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... Mitsuuchi. Y. , Toda, K., Miyahara, K.,Yokoyama, Y. , Nakao, K., Hosoda, K., Y amamoto, Y. , I mura,H. & Shizuta, Y. (1990) Cloning of cDNA and genomic DNA forhuman c ytochrome P-45011 beta. FEBS ... cardiovascular or endocrine diseases,Fig.3.Assessmentof11b-h ydroxylase a ctivity and determination of 11b-hydroxylase capacity. (A) Assessmentof11b-hydroxylase activity of CYP11B2 var iants e xpressed i n ... Mitsuuchi, Y. , O hnishi, T., Ichikawa, Y. ,Yokoyama, Y. , Sumimoto , H., Toda, K., Miyahara, K.,Kuribayashi, I. & Nakao, K., et al. (1990) Cloning and expression of a cDNA for human cytochrome...
- 10
- 648
- 0
Báo cáo y học: "The effect of high correlated colour temperature office lighting on employee wellbeing and work performance" ppt
... m. Each work area has dark floors and white walls. Floors have windows on approximately80% of both their East and West wall areas. Blinds arepresent and used in such a way that typically more ... forthe study.Authors' contributionsPM developed the study protocol, collected the data and contributed to data analysis and writing of the manu-script.ST analysed the data and contributed ... last 3 days?11. On a scale of 1 to 10, where 1 is not alert at all and 10is fully alert. All things considered, how alert and able toconcentrate have you been over the last 3 days?The second...
- 9
- 403
- 0
Báo cáo hóa học: " The effect of an autologous cellular gel-matrix integrated implant system on wound healing" pot
... Facultad de Farmacia, Universidad de Valparaíso, Avenida Gran Breta a 1093, Playa Ancha Valparaíso, Casilla 5001-V, Valparaíso, Chile, 2Departamento de Ciencias Farmacéuticas, Facultad de Farmacia, ... Santa Mar a, Casilla 110-V, Valparaíso, Chile, 5Facultad de Ciencias Naturales y Exactas, Universidad de Playa Ancha de Ciencias de la Educación Avenida Leopoldo Carvallo 270, Playa Ancha, ... Estadística, Facultad de Ciencias, Universidad de Valparaíso, Avenida Gran Breta a 1111, Playa Ancha, Valparaíso, Chile, 8Clínica Veterinaria La Protectora, Levarte 833, Playa Ancha, Valparaíso,...
- 11
- 497
- 0
Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx
... OPG.forOPG.rev5'-AGAGCAAACCTTCCAGCTGC-3'5'-CGCTGCTTTCACAGAGGTCA-3'RANK AF19046 1422–1440 RANK.forRANK.rev5'-TGCCTACAGCATGGGCTTT-3'5'AGAGATGAACGTGGAGTTACTGTTT3'RANKL ... intestinal peptide and pituitaryadenylate cyclase-activating polypeptide on osteoclast forma-tion are associated with upregulation of osteoprotegerin and downregulation of RANKL and RANK. Biochem ... inflammatory, erosive arthritis (collagen-induced arthritis (CIA) [6] accompanied by infiltration of thesynovial membrane and synovial cavity as well as by extensivelocal bone and cartilage...
- 12
- 418
- 0
Báo cáo y học: "Therapeutic effect of the potent IL-12/IL-23 inhibitor STA-5326 on experimental autoimmune uveoretinitis" pot
... mg/kg STA-5326 (SyntaPharmaceuticals Corporation, Lexington, MA) or vehicle only(0.5% carboxyl methyl cellulose) was orally administered once a day for six days a week from day 0 to day 14 after ... severity was evaluated on day 15 and day 18 after immunization. Fundus examination revealed that STA-5326 treatment significantly reduced the severity of EAU on day 15 (Figure 4). This suggests that ... clinical and histopathological analysisOral administration of STA-5326 reduces the severity of experimental autoimmune uveoretinitis (EAU) by clinical and histopathological analysis. (a) Clinical...
- 8
- 441
- 0
Báo cáo y học: "Beneficial effect of the oxygen free radical scavenger amifostine (WR-2721) on spinal cord ischemia/reperfusion injury in rabbits" docx
... [22-24]: a) mitochondrial dysfunc-tion, leading to a failure of aerobic energy metabolism and lactate accumulation, b) activation of mitochondrial and cytoplasmic nitric oxide synthase (NOS) and ... chemo-attractants for polymorphonuclearleukocyte and macrophage influx, and) activation of thecalcium-activated cysteine protease calpain which ismediating axonal damage in SCI.One of the consequences ... Masetti P, Rokkas CK, Murphy SF, Blackstone EH:Safety and efficacy of hypothermic cardiopulmonary bypass and circulatory arrest for operations on the descending tho-racic and thoracoabdominal...
- 12
- 349
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... of vital (life threatening) danger possibleNACA 5 Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, ... wasclassified (table 2).The NACA score system was chosen because it iseasy to use retrospectively and the air ambulances useZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and ... article as: Zakariassen et al.: The epidemiology of medicalemergency contacts outside hospitals in Norway - a prospectivepopulation based study. Scandinavian Journal of Trauma, Resuscitation...
- 9
- 784
- 0
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"
... University of Calgary, Calgary, AB T2N 2T9, Canada3Department of Medicine, University of Calgary, Calgary, AB T2N 2T9, Canada4Alberta Kidney Disease Network, Calgary, AB T2N 2T9, Canada5Calgary ... of ICU-acquired hyponatraemia and hypernatraemia varies according to patient characteris-tics.• ICU-acquired hyponatraemia and hypernatraemia are associated with increased risk of hospital ... mediannumber of days of hyponatraemia (IQR = one to three days) and hypernatraemia (IQR = one to five days) was two.Multivariable analysis of patient characteristicsThe incidence of ICU-acquired...
- 8
- 721
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... ra-tionale after the initiation of NARP. Also carbapenem resistance rates of Pseudomonas spp and Acinetobacter spp decreased correlating with decreased consump-tion of carbapenems after NARP ... of boxes were calculated from two databases, 1) Hospital pharmacy computer data-bases, and 2) International Medication System (IMS). Because Turkey is an inflation country we have esca-lated ... The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy1, Cenk Aypak2, Alpay Azap1, Önder...
- 6
- 692
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ