Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B andfamily 2 cystatins and also what residues of this loop in cystatin A may participate in the interaction.To ... Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G ... of cysteine proteases, in particular cathepsin B. The role of this loop is comparable to that of the corresponding loops of cystatin B and family 2 cystatins, to stabilize the cystatin protease...
- 10
- 533
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... kcatrepresents the rate of acylation and Kmequals the binding constant of the substrate to the free enzyme. The results then indicateÓ FEBS 2002 Role of active-site phenylalanines in penicillin acylase ... the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site.To test the effect of the mutations on the specificity forphenylacetylated substrates, the steady-state ... phenylalanine was thereforemutated to Ala, Leu, Trp or Tyr. These mutations may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme...
- 8
- 561
- 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... 2002 The role of zinc in the methylation of the coenzyme M thiol group in methanol :coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy Markus ... presence of coen-zyme M, indicate how zinc interacts with its substrate coenzyme M and how zinc is most probably coordinated in the active site of this methyltransferase. Upon binding of coenzyme M ... & Grahame, D.A. (1996) Specificroles of methylcobamide :coenzyme M methyltransferase isozymes in metabolism of methanol and methylamines in Methanosarcina barkeri. J. Biol. Chem. 271, 5189–5194.25....
- 7
- 464
- 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... Taiwan;3Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the biosynthesis ... type of mutant,represented by arginines 306 and 307, are located in the C- terminus. They appear to modulate the activity of the C- terminus, which encloses the DAOCS active site during catalysis ... The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase Sarah J. Lipscomb1,*, Hwei-Jen Lee1,2,*, Mridul Mukherji1, Jack E. Baldwin1, Christopher...
- 5
- 462
- 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... purposes)c) The role of probiotics in Allergic RhinitisReports on the efficacy of probiotics in treating allergic rhinitis are conflicting. Some studies suggest efficacy suchas the study by Wang and ... allergy.factors influencing development of the microbiota. Ann Med1999, 31(4):288-92.15. Kalliomaki M, Isolauri E: Role of intestinal flora in the develop-ment of allergy. Curr Opin Allergy Clin ... The role of the intestinalmicroflora for the development of the immune system in early childhood. Eur J Nutr 2002, 41(Suppi 1):I32-7.18. Penders J, et al.: Molecular finger printing of the intestinalmicrobiota...
- 7
- 560
- 0
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc
... their role in bone metabolism and repairremains unclear.Review of the evidenceTo determine the role of COX-2 in bone repair, investiga-tors have studied fracture healing in animal models of COX-2 ... 17:963-976.11. Einhorn TA. Do inhibitors of cyclooxygenase-2 impair bone healing? J Bone Miner Res 2002, 17:977-978.12. Zhang X, Schwarz EM, Young DA, Puzas JE, Rosier RN, O’KeefeRJ: Cycloxygenase-2 ... activity of a glucocorticoid-regulated inflammatorycyclooxygenase. Proc Natl Acad Sci USA 1992, 89:4888-4892.7. Raskin JB: Gastrointestinal effects of nonsteroidal anti-inflam-matory therapy....
- 3
- 475
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
... high and constant level of c-Myc. Also, the contribution of Ras/Raf/ERK prevented the rapid degradation of c-Myc byphosphorylation of the serine 62 residue in the N-terminal of c-Myc [24]. They ... determine if c-Myc transcriptioninhibitor obstructed the effect of TGF1, and (3) determine the role of ERK1/2 in stabilizing the expression of c-Myc. Materials and methodsAntibodies and reagentsRecombinant ... hypothesizedthat c-Myc plays a central role in TGF1 signaling for cellgrowth stimulation. Additionally, to examine the possibility of involvement of the MAPK pathway in regulation of c-Myc sta-bility, we...
- 12
- 535
- 0
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt
... evidence for hypoxia in inflammatory and destructive joint disease, and discusses theinterplay between alterations in oxygen tension, vascularity and inflammatory signalling pathways. In the present ... formyeloid cell-mediated inflammation and bactericidal capacity of phagocytes, suggesting crosstalk between angiogenesis and inflammation.Review Hypoxia The role of hypoxia and HIF-dependent signalling ... contains an evolutionarily conserved LxxLAPconsensus motif for hydroxylation by PHD, thus linking twomajor human signalling systems, namely NF-κB and HIF.Mimicking hypoxia by treatment of cells...
- 9
- 499
- 0
Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx
... consequently lead to increasing inter-est in the role of osteoclasts in local bone erosion that isdriven by the hypothesis that synovial pannus makes useReviewThe role of osteoprotegerin in arthritisGeorg ... Collagen-induced arthritisSpecies Rat Mouse RatDose 1 mg/kg/day 6.4 mg/kg/day 3 mg/kg/dayStart Onset of symptoms Onset of symptoms Onset of symptomsDuration 7 days 35 days 5 daysEffect on inflammation ... page of themanuscript published by Anton Weichselbaum in the Archives forPathology, Anatomy, Physiology and Clinical Medicine in 1878. (c)Title of the manuscript, meaning “The finer changes of...
- 7
- 343
- 0
Báo cáo y học: "The role of statins as potential targets for bone formation" pptx
... all bone resorption inhibitors, which act mainly to stabilize bone mass by inhibiting the activity of osteoclasts (the cellsresponsible for bone loss). The ability of these drugs toincrease bone ... anCommentaryThe role of statins as potential targets for bone formationI Ross Garrett1and Greg R Mundy21OsteoScreen, San Antonio, Texas, USA2The Institute of Drug Development, San Antonio, Texas, ... Mundyovergrowth of bone, leading to osteosclerosis. Since new bone formation is primarily a function of the osteoblast,agents regulating bone formation can act by eitherincreasing/decreasing...
- 4
- 392
- 0
Báo cáo y học: "The role of structural genes in the pathogenesis of osteoarthritic disorder" potx
... and in the pathogenesis of OA.Keywords: cartilage, chromosomes, genetics, linkage, osteoarthritisReview The role of structural genes in the pathogenesis of osteoarthritic disordersAnthony M ... the genes encoding these structural components of the matrixhave provided insight into the function of the individual geneproducts in the pathogenesis of OA.Osteoarthritis (OA), one of the most ... theseforms of OA. They include the type II and type XI col-lagenopathies, the multiple epiphyseal dysplasias (MEDs),and the metaphyseal chondrodysplasias. They are usuallyinherited as fully penetrant...
- 9
- 403
- 0
Báo cáo y học: "The role of traditional healers in tooth extractions in Lekie Division, Cameroon" docx
... AccessThe role of traditional healers in tooth extractions in Lekie Division, CameroonAshu M Agbor1*, Sudeshni Naidoo1and Awono M Mbia2AbstractBackground: The extraction of the teeth by traditional ... skele-tons of Early Iron Age populations (ca. 1500 yearsbefore present)[3]. Traditional healers in Africa have been carry ing outsurge ry ranging from circumcision during initiation cer-emonies, traditional ... knowledge of the researchers,thisisthefirststudyreportingtheuseofamedicinalplantbyTHfor tooth extractions in Cameroon. Extractions are carried out using the fresh leaves andstems of Dichrocephala integrifolia,...
- 8
- 503
- 0
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot
... CentralPage 1 of 7(page number not for citation purposes)Journal of InflammationOpen AccessResearchThe role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal musclesSusan ... viability in all types of muscle.Conclusion: These results show that in skeletal muscle, IR injury is dependent upon both thepresence of mast cells and on fibre type and suggest that a combination of ... injury, thus proving that mast cells play a pivotal role in IR injury to skeletal muscle [5]. Our IR injury model consists of 70minutes tourniquet hind limb ischaemia followed by 24h reperfusion. Unlike...
- 7
- 400
- 0
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx
... mortality caused by WSSV. The results suggestedthat F1 -ATP synthase beta subunit plays a role in the WSSV infection. ConclusionsF1F0 -ATP synthase complexes play a central role in the synthesis ... F1 ATP synthase beta subunit nucleotide-binding domain, ATP synthase alpha/ beta chain N terminal domain, ATP synthase alpha /beta chain C terminal domain according to the NCBI Con-served Domain ... with WSSV, and for the first time describe the role of F1 -ATP synthase beta subunit during WSSV infection. ResultsA 53 kDa shrimp protein binds to WSSV by VOPBAVirus overlay protein binding...
- 9
- 363
- 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... that p 21/ waf1 and cyclin D2 are complexed together in HTLV -1 infected cells.Cell cycle analysis of cyclin D2 and p 21/ waf1 p 21/ waf1 has been previously described as an assemblyfactor for cyclin ... cdk4, cyclin E, p 21/ waf1 wildtype (WT), p 21/ waf1 mutant in the cyclin binding site (mut), p16/INK4A, and cyclin D2 were expressed and purified using affinity tag chromatography. Following purification ... http://www.retrovirology.com/content /1/ 1/6Page 8 of 17 (page number not for citation purposes)waf1 mutant in cyclin binding site (mut), p16/INK4A, cyclin E, and cyclin D2 in insect cells, and purified themusing affinity tag...
- 17
- 299
- 0
Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM