0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions Ronald P. de Vries1†, Lucie Parˇenicova´1‡, Sandra W. A. Hinz2, ... Potatoarabinogalactan consists of 86%D-galactose and 6.6%L -arabinose, while soy arabinogalactan consists of 57%D-galactose and 38%L -arabinose. Methylation analysisdemonstrated that a substantial amount ... arabinogalactans from potato, onion and soy was determined as described [21].Onion arabinogalactan consists of 99%D-galactose and 0.3%L -arabinose and is predominantly linear. Potatoarabinogalactan...
  • 9
  • 669
  • 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

... Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 Emily Crowley1, Megan L. O’Mara2, Ian D. Kerr3 and Richard Callaghan11 Nuffield Department ... indicate thatTM12 plays a key role in the progression of the ATP hydrolytic cycle in ABCB1 and, in particular, in coordinating conformational changes betweenthe NBDs and transmembrane domains.AbbreviationsABC, ... number of investigations to datehave implicated transmembrane helix 12 (TM12) in mediating communica-tion between the transmembrane domains and nucleotide -binding domains(NBDs) of ABCB1. The...
  • 12
  • 380
  • 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion Tomoaki Hishida, Tsuyoshi Eguchi, Shigehiro Osada, Makoto ... results imply thatfad49 is crucial in the immediate early stage of adipocyte differentiation. As fad49 appears to play an important role in the early stages of adipocyte differentiation, we focused ... enhancer-bindingprotein b (C ⁄ EBPb) and C ⁄ EBPd at the immediate early phase. Takentogether, these results show that fad49, a novel gene, plays a crucial role in the immediate early stage of adipogenesis.AbbreviationsaP2,...
  • 13
  • 385
  • 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

... 5Â-ACCACTCTCTGGATGTGATTGGA-3Âand 5Â- TCAAGAACATTTTATTTCCCACATTTT-3Â forUgt2b5; 5Â-ATTGCCCATATGGTGGCCAAAGGAG-3Âand 5Â- GGCTGCCACACAAGCGAGTAGGAAT-3Â forUgt2b37; 5Â-GGGAAGGACATGAAGGAGAGAGC-3Âand ... 5Â-AGAGATGATCCCATGAGAAACGGTGAA-3Â for Cyp 3a4 4; 5Â-AGATCATCATTCCTTGGCACTGG-3Â and 5Â- ATTGCAGAAAGGAGGGAAGATGG-3Â for Cyp 4a1 0; 5Â-CCAGTTGAGTGACGAGGAGATGG-3Â and 5Â-TCTGCATGCCCTCAAATGTTACC-3Âfor Akr1b8; ... Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors Kiyoto Motojima and...
  • 9
  • 280
  • 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... component of the cell walls of Gram-negative bacteria, is an importantmicrobial molecular pattern that initiates in ammatoryand coagulation reactions as part of the host innate immune response to infection. ... decreasingTNF -a mRNA levels in MonoMac-6 cells. Taken together, the data from these studies suggest that LPCAT is a key enzyme in both the pathways of activation (priming) and the in ammatory response to ... 2003 Monocyte acyltransferase in inflammation (Eur. J. Biochem. 270) 2787 Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide Bernhard Schmid1,2,...
  • 7
  • 322
  • 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... 4).Similarly, Shaanan [31] reported the stereochemistry of the iron -dioxygen bond in human HbO2by single-crystalX-ray analysis. In the a chain, the distance between Ne of His (E7) and the terminal ... HbO2,and 50 lMfor valency hybrid Hb.Ó FEBS 2002 The a1 b1 contact in HbO2autoxidation (Eur. J. Biochem. 269) 207 The a1 b1 contact of human hemoglobin plays a key role in stabilizing the bound ... At the a1 b1anda2b2interfaces, on the other hand, negligible changes are foundinsofar as the crystal structure was examined. Consequently,these are called simply the packing contacts, and their...
  • 10
  • 648
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

... Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in blood stimulated by a wide array of platelet agonists including atherosclerotic plaque. By specifically ... stimulus-induced platelet secretion and aggregation in blood. Methods: Human platelet aggregation and ATP -secretion were measured in hirudin-anticoagulated blood and platelet- rich plasma (PRP) by using ... 8:128http://www.translational-medicine.com/content/8/1/128Page 8 of 10 RESEARC H Open AccessRac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaqueSuman Dwivedi1,...
  • 10
  • 441
  • 0
báo cáo hóa học:

báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

... RESEARC H Open Access LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injuryKeri B Vartanian, Susan L Stevens, ... lead to NFBactiva-tion and pro-inflammatory responses. In contrast, TLR signaling pathways that a ctivate IRFs can induce anti-inflammatory mediators and type I I FNs that have beenassociated ... TLR4 signaling and NFBactivationisnotthesolesourceofthese pro-inflammatory cytokines in response to ischemic injury, implicating other signaling cascades andtranscription facto rs in the inflammatory...
  • 12
  • 215
  • 0
Báo cáo y học:

Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx

... analpha2delta ligand, reduces the development of experimental osteoarthritis by inhibiting metalloproteinases and inducible nitric oxide synthase gene expression and synthesis in carti-lage chondrocytes. ... goodquality of life. Consequently, the challenge of improving the ACL: anterior cruciate ligament; ASU: avocado/soybean unsaponifiables; iNOS: inducible nitric oxide synthase; MMP: matrix metalloproteinase; ... An in vivo study with N-iminoethyl-L-lysine, a potent and selective iNOS inhibitor [52], demonstrated its therapeuticeffectiveness in reducing the progression of experimental OA in the ACL dog...
  • 9
  • 547
  • 0
Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

... RESEA R C H Open Access Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla Samuel ... article as: Chan et al.: Extracellular signal-r egulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla. ... demonstrated that activation of MEK1/2, ERK1/2 and MNK1/2 in RVLM plays a preferential pro-life role by sustaining the central cardiovascular regulatory machinery during brain stem death via upregulationof...
  • 9
  • 201
  • 0
Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps

... article as: Dai et al.: Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla. Journal ... activation by HIF-1 in RVLM plays a preferential pro-life role by sustaining central cardiovascular regulatory functions during brain stem death via upregulation of NOS I/PKG signaling pathway. ... 5′-TCTGAAGACATTGTTGCTGA-3′ .The corresponding sense o ligonucleotide: 5′ -TCCAGCGGCGTCAGCGGTGC-3′ (ho-1)or5′-GATCTGACTT-CAAG TGATTG-3′ (ho-2) or scrambled oligonucleotide:5′-CAGTCCCGCGATGGAGCGCC-3′...
  • 12
  • 123
  • 0
báo cáo khoa học:

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 11:19http://www.biomedcentral.com/1471-2229/11/19Page 8 of 10 RESEARCH ARTICLE Open Access The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in ArabidopsisHatem ... Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T,Buchner P, Hawkesford MJ, Yamaya T, Takahashi H: Vacuolar sulfate transporters are essential determinants controlling internal ... Takahashi H, Watanabe-Takahashi A, Smith FW, Blake-Kalff M,Hawkesford MJ, Saito K: The roles of three functional sulphatetransporters involved in uptake and translocation of sulphate in Arabidopsis...
  • 10
  • 427
  • 0
Báo cáo y học:

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

... CTACCAAGCCTCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA-TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAACCTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTGCCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT-TAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAGGAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG-TTTTTGCTGTACGTACAGCAAAAACTATT ... GTAGGAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG-TTTTTGCTGTACGTACAGCAAAAACTATT CTTA-AT GCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAA-GAATAGTTT TTGCTGTAC/GTACAGCAAAAAC-TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCTCC,696+ 2A, ... TTGCTGTAC/GTACAGCAAAAAC-TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCTCC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAA-TAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAGCTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGG-TAGGTGCTGCCTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAGCTAAGG-CAG...
  • 12
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

... 98:5306-5311.41. Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchi-yama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, AuwerxJ, ... the hepatocyte and protects the normal paren-chyma against liver injury [32]. Jak2 participates in transduc-tion of interleukin (IL)6 signaling in case of acute phasereaction, as well as in ... D (Additionaldata file 1, D) with the up-regulation of STAT1, one of the major components of the type I IFN transduction pathway,playing a key role in antiviral defense, inflammation andinjury...
  • 14
  • 384
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

... Zhang et al.: Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells. Genetic Vaccines and Therapy 20119:3.Submit ... natriuretic peptide signaling in modulatingasthma and inflammation. Can Physiol Pharmacol 2007, 85:754-9.3. Piechota M, Banach M, Jacon A, Rysz J: Natriuretic peptides in cardiovascular diseases. ... atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cellsWeidong Zhang1†, Xueqin Cao2†, Dongqing Chen1, Jia-wang Wang3, Hong Yang4,...
  • 12
  • 268
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ