Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

... amplified by two primer pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... distribution of the genetic variants CCR5-Delta 32 and CD45-C77G in a cohort of Italian het- erosexually HIV-1 exposed and uninfected individua...
Ngày tải lên : 10/08/2014, 05:20
  • 4
  • 384
  • 0
Báo cáo y học: "The protective effect of licofelone on experimental osteoarthritis is correlated with the downregulation of gene expression and protein synthesis of several major cartilage catabolic factors: MMP-13, cathepsin K and aggrecanase" docx

Báo cáo y học: "The protective effect of licofelone on experimental osteoarthritis is correlated with the downregulation of gene expression and protein synthesis of several major cartilage catabolic factors: MMP-13, cathepsin K and aggrecanase" docx

... Scientific, Nepean, ON, Canada), deparaffinized in xylene, rehydrated in a reverse-graded series of ethanol, and preincubated with chondroitinase ABC 0.25 units/ml (Sigma-Aldrich Canada, Oakville, ON, Canada) ... Lohmander LS, Neame PJ, Sandy JD: The structure of aggrecan fragments in human synovial fluid: Evidence that aggrecanase mediates cartilage degradation in inflammatory...
Ngày tải lên : 09/08/2014, 06:23
  • 12
  • 1.2K
  • 0
Báo cáo y học: "QT interval prolongation related to psychoactive drug treatment: a comparison of monotherapy versus polytherapy" pdf

Báo cáo y học: "QT interval prolongation related to psychoactive drug treatment: a comparison of monotherapy versus polytherapy" pdf

... Clin Psychopharmacology 2001, 21:8-13. 5. Czekalla J, Kollack-Walker S, Beasley CM: Cardiac Safety param- eters of olanzapine: comparison with other atypical and typ- ical antipsychotics. J Clin ... and ana- lysed the results. CM ran the statistical analysis. AB and EC Mean QTc (bars indicate standard deviations) values at base-line (T0) and after four days at full dosage (T1) of antipsy-...
Ngày tải lên : 08/08/2014, 21:20
  • 6
  • 348
  • 0
Báo cáo y học: "Extracellular mitochondrial DNA and oxidatively damaged DNA in synovial fluid of patients with rheumatoid arthritis" potx

Báo cáo y học: "Extracellular mitochondrial DNA and oxidatively damaged DNA in synovial fluid of patients with rheumatoid arthritis" potx

... cellular damage in inflammatory loci, thus creating a vicious circle of inflammation and cell destruction and an increased release of endogenous, pro- inflammatory DNA. In the particular case of arthritis, ... con- centration of 4.0 mM MgCl 2 . PCR analysis of extracellular mtDNA in the clinical samples The results of a typical PCR analysis of plasma and SF samples are...
Ngày tải lên : 09/08/2014, 01:23
  • 7
  • 308
  • 0
Báo cáo y học: "Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice" pps

Báo cáo y học: "Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice" pps

... GCAGAGAGGAGGTTGACTTTC IL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG MCP-1 CCACTCACCTGCTGCTACTCAT TGGTGATCCTCTTGTAGCCCTCC Ccl5 GTCGTGTTTGTCACTCGAAGGA TTGATGTATTCTTGAACCCACTTCTT iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCG COX-2 ... CATTGGAAGTGAAGCGTTTCG COX-2 GTGGAAAAACCTCGTCCAGA GCTCGGCTTCCAGTATTGAG β-Actin AGGTCATCACTATTGGCAACGA CACTTCATGATGGAATTGAATGTAGTT Open Access Available onl...
Ngày tải lên : 09/08/2014, 07:20
  • 9
  • 270
  • 0
Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

... to that of the polyethylene and polymethylmethacrylate particles. The bone, similar to the polymeric materials, induced a granulomatous inflammatory reaction. However, in contrast to the polymeric ... protein and bone sialoprotein show marked changes during rat femoral head development. Matrix Biol 1995, 14:773-781. 14. Sabokbar A, Fujikawa Y, Neale S, Murray DW, Athanasou NA: Human a...
Ngày tải lên : 09/08/2014, 07:20
  • 10
  • 386
  • 0
Báo cáo y học: " Traditional Indian medicine and homeopathy for HIV/AIDS: a review of the literature" docx

Báo cáo y học: " Traditional Indian medicine and homeopathy for HIV/AIDS: a review of the literature" docx

... of Ayurveda, Yoga-Naturopathy, Unani, Sid- dha and Homoeopathy (AYUSH), which is part of the Ministry of Health and Family Welfare. The mission of AYUSH includes: a) an initiative for integrating ... Deivanayagam CN, Krishnarajasekhar OR, Ravichandran N: Evalua- tion of Siddha medicare in HIV disease. J Assoc Physicians India 2001, 49:390-391. 7. Singh P, Yadav R, Pandey A: Util...
Ngày tải lên : 10/08/2014, 05:21
  • 9
  • 517
  • 0
Báo cáo y học: " Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China" potx

Báo cáo y học: " Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China" potx

... County, disease was a major factor causing animal mortality and constraining the development of animal husbandry [9]. The morbidity and death rates of animals in the three Nu villages was found ... diseases by dogs and other animals that come into contact with carcasses (Table 3). In recent years, with variable and unpredict- able temperature and rainfall, climate change has been in...
Ngày tải lên : 10/08/2014, 09:21
  • 10
  • 459
  • 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA ... domain of phytochrome-like proteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 an...
Ngày tải lên : 08/03/2014, 23:20
  • 10
  • 499
  • 0
Báo cáo y học: "Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample" pdf

Báo cáo y học: "Hospital Anxiety and Depression Scale (HADS): validation in a Greek general hospital sample" pdf

... Panayiota Michalopoulou †1 , Georgia Kalemi †1 , Katerina Fineti †1 , Paulos Patapis †2 , Konstantinos Protopapas †3 and Lefteris Lykouras* 1 Address: 1 Second Department of Psychiatry, Athens ... co-designer of the study and participated in data collection, KF participated in data collection and processing, PP participated in data collec- tion and processing, KP participated i...
Ngày tải lên : 08/08/2014, 23:20
  • 5
  • 532
  • 0

Xem thêm

Từ khóa: