0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

Báo cáo y học:

Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

... citation purposes)AIDS Research and TherapyOpen AccessShort reportCytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutationLisa ... acid peptide incorporating 103N was recognized by patient T cells whereas the wildtype was not. The RT K103N mutation is selected by the NNRTI class of HIV drugs. Wehypothesize that, in certain ... mutations during therapy. The K103N mutation is a common cause of RT NNRTI drug resistance. Clinically, this mutation is potent as a sin-gle mutation and causes cross resistance to drugs in thisclass...
  • 4
  • 259
  • 0
Báo cáo y học:

Báo cáo y học: "Angioimmunoblastic T-cell lymphoma presenting as giant kidneys: a case report" ppsx

... analysis of the gamma T- cell receptor rearrangement showed mono-clonality of the T cells, which raised the possibility of T- cell lymphoma. Infiltration by lymphocytes stainedmostly for CD3 (T ... 20 kg during the preceding two months. The results of the physical examination and laboratory tests raised the possibility of neoplastic disease. A computerizedtomographic scan of the abdomen ... cited.AbstractIntroduction: Angioimmunoblastic T- cell lymphoma is a rare form of tumor of the lymph nodes orlymphoid tissue. In this report we describe an unusual presentation of angioimmunoblastic T- cell lymphoma...
  • 4
  • 391
  • 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx

Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx

... the selection of the correct template and in the expected ®nalquality of the model. Other information, such as predictedand observed secondary structures of the target andtemplate proteins, and ... knownprotein structures neither found any of these structures, norhighlighted any other statistically signi®cant homologies. The structures of the HERG and FixL P AS domains areshowninFig.1togetherwiththePYPstructure.Giventhelow ... below the aromatic rings. This led to the hypothesis that there are favorable interactions with areceptor nucleophilic site in the central part of the ligandand with electrophilic sites at both...
  • 6
  • 569
  • 0
Báo cáo y học:

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

... substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled acquisition of data. All authors contributed to the manuscript revision ... comorbidity, the most common reason why patients met the effectiveness algorithm criteria but failed to meet the gold standard criteria was that the physician and patient were satisfied with the ... were attributable to the treatment started on the index date, rather than to natural variations in disease activity; switching to a different RA medication after the index date; or other factors....
  • 29
  • 581
  • 0
Báo cáo Y học: Differential scanning calorimetric study of myosin subfragment 1 with tryptic cleavage at the N-terminal region of the heavy chain pdf

Báo cáo Y học: Differential scanning calorimetric study of myosin subfragment 1 with tryptic cleavage at the N-terminal region of the heavy chain pdf

... importance for the structuralintegrity of the myosin head. An important role of the N-terminal region of the myosin head in the communicationbetween the motor domain and regulatory domain can ... binding of the head to F-actin [19]. Therefore it can be suggested thatactin-induced structural changes play an important role in the motor function of the myosin head.Hence the use of the DSC method ... For both proteins, the formation of the ternarycomplexes causes a significant shift of the thermal transitionto higher temperature and the effect of BeFxis lesspronounced than the effect of...
  • 11
  • 432
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... black staining was used to confirm proteinpresence and to detect bands not stained by the rutheniumred dye.Analysis of antifreeze activityAntifreeze activity was quantitated a s thermal hysteresis,which ... have enhanced binding to iceand this is not likely to be the case. This may be relevant to the calculation of smelt AFP activity. The activity of smeltAFP is about one-third of that of sea raven ... mass of % 5 kDa. The removal of the carbohy-drate moiety had no effect on any of the characteristics of smelt AFP that were investigated. However, the possibility of alternative and untested...
  • 8
  • 518
  • 0
Báo cáo Y học: Puri®cation and properties of an alkaline proteinase of Fusarium culmorum doc

Báo cáo Y học: Puri®cation and properties of an alkaline proteinase of Fusarium culmorum doc

... sequence. The hydrolytic speci®city of the enzymeWhen the hydrolytic activities of the proteinase weremeasured at pH 9.0 with various synthetic substrates, the results listed in Table 5 were obtained. ... indicates thatthese peptides were probably separated by an autolytic e ventrather than by trypsin hydrolysis. In the subsequentdiscussion the peptides 3 and 4 are considered as a single peptide. Table ... corresponded to that of the other subtilisin-like enzymes (Table 4). This is anotherstrong indication that the enzyme under study is a subtilisin-like, not a chymotrypsin-like, proteinase. These resultstherefore...
  • 10
  • 350
  • 0
Báo cáo y học:

Báo cáo y học: " Psychological distress among patients of an orthopaedic outpatient clinic: a study from a low-income country" docx

... hospital [19]. The patients first present to the outpatient clerk who willdirect all patients with musculoskeletal complaints to the orthopaedic outpatient department. The Research EthicsCommittee ... patients seeing the doctor that day.After explaining the study in full and obtaining writteninformed consent, the research assistants administered the Urdu translation of the screening instruments: ... consultation with the doctor. The research assistants were trained by the author (NH)in the use of the SRQ and other measures. The surgeondocumented the diagnosis and whether the presentingissue...
  • 7
  • 278
  • 0
Báo cáo y học:

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... containing DHPC micellesTo delineate the structural stability of the apoE-(72-166)peptides with or without DHPC, the GdnCl denaturationexperiments were executed. The denaturation of the three ... the highest DMPC turbidityclearance ability. By fitting to biexponential decay model(Eq. 3), it suggested that the rate constants of apoE4-(72-166) in both phase were 4-13 times faster thanapoE2 ... undergoes proteolysis to yieldNT- and CT-truncated that interact with cytoske letalcomponents to form NFT-like inclusions in neuronalcells [16]. To understand the pathogenesis of differentisofomic...
  • 9
  • 333
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... copies of DR2 (ACGCTCACTGGAACACTGGAATGCCCAGTTCTCGTCGCTCACTGGAACACTGGAATGCCCAGTTCTCGTTCGCTCACTGGAACACTGGAATGCCTCTAG) upstream of the thymidine-kinasepromoter of reporter plasmid pUTK-Luc vector, ... Importantly, the interaction of SmNR1 ⁄ SmRXR1 is demonstrated by in vitro (GSTpull-down assays) and in vivo (yeast two-hybrid andmammal cell assays) results. Likewise, the ability of the heterodimer ... us to understand how they regulate signalingpathways in the schistosome itself and to understand the molecular relationship between the schistosomeand vertebrate and snail hosts. Recently two...
  • 16
  • 542
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ